Description :
From Genome Similarity Track
Location :
Scaffold_115:64313- 68045
Transcript NameFunction/comments
Phypl_g3476hypothetical protein PHYSODRAFT_543861

Sequence
3732 bases(100 bases per row)
ATGGACACGGAGGGCTTCACGTCGCGCGCGTGGCTGGGCCACTGGGTCTCGGGCGAGGAGGACCCCGTGAACAACTACTACGAGGACCACAAGCTCATGG
AGGGCGCGCTCATCAAGCTGGGCGACTACGCGCACTTCCGCTACTTCCTGCTGTTCCGCAACGGCCGCTTCTGCTACTACGAGCTGCCCATgcccacggc
ggcgcccGGGGGCGGACCCGAGGGCCCCAGGCGCGTGCACCTGACGCTCACGTCCAAGCACCTGCGCGGCGTCATGATGCTCAACGCGTCGGTGAACGCC
AAGGACCTGgccaagagcgaggacgagtacgacgcCGACCTCATCAAGCGCGGGCTCGTGTTCAaccgcaagaagctcgagatgcAGCTCACGGGCTACT
CGCCCACGGGGCAGCTCAtgtgctggaagctgcgggCCGGCAAGGACGCCGTGTACCTCAAGTGGGAGCGCGCCTTCCGACTGGCGCTGCGCCCCATCTG
GGTGCAGAACTCCAAGTGCTGCATGGTCTGCAAGAAGGagttcagcttcttcatccgCCCGCACCACTGTCGGTACGTTAcactgcagcgccaagtgGTA
GCAGTTAGTTAGTTACAGGAGTGATATTGACGTCTTGACTGTCTGTTGCAGCAAGTGCGGCACGTGCATGTGCGACGAATGCTCGGTGTTCGTCCCGCGC
CTGCCGATGCAGGGGTACTACGACGAAGTGCGCATCTGCCGGGACTGCTCGCCGATCAAGATCCAGCGATCGTCGCTGAAACTGGGCACGCGCGTGTTGG
TGTACGGAATTTTGGTCGGTAGAGTGGTGCAGGTGGATGCTGCAGATGACTCGGTGGACGGAAGGGCGTTCGTGAACGTggagctcgacaagaagaacaa
cCAGCTACGTCGATTTGCACTAGAGCACGTGGAGCTCTACTCCGATGCGGTGCTGTCAGCCAACCGCATCAAGAATGCCATCCGTCAGCACCTATCGTAT
GCTGTGTTTCGGACACAGCTCAACTTTAACACATGGAATTTGCTGGAGACcgtgcaggagcagcgcacAGTTCAGATGGTACGGATACTCAACAAGTCGA
CCAGCATCAATGAGCTGCACTCGATGGTGCCGATGCTCGGCTCGTTAGACACGATGCAGTTTCCCGACGACGATGTATCCGAAAATGATCGTGTGAAGGA
GTCCCTTTCGCATTACCGCGGTGTGCATGTGTCGTTTCCGTTGCGATTGGACACGGTGAAGAAGCTTATTAACCAGTTCCGCAATGGCATTTTGCTGCAC
CGCGTCTTCGTGCGTCAGATCTTGGACGAATCGGAAAAGCTGTTCCGAAAGATGCACGAGTCGCCAATGAACGAGATCGAGATTCCTGTGGGCGTGCAGT
TGGTCGTTGTAGGTGACCTTCATGGGCAGTTGGAAGATTTGCTCACAATTATGGACAAGAATGGTGTGCCTAGCAGTAAAACCTGGTATCTCTTCAATGG
CGACTTCGTGGACCGCGGATCGCACGGAATCGAGgtcatcctgctgctgctaatATTCAAGCTATTGTACCCCGGTTACGTCTTCTTGAACCGCGGCAAC
CACGAAGAACGTATGATCAACGAGGTTTTCGGGTTCGAGGATGAAGTGTATATCAAGTACGGCacagacaacgacgaggTTGCTGGGTGGAGTGGACTGG
GCACATCGATCAGTTATTCGCCCATGAAGCTCTTTCAGATGTTCGAGACGGTTTTTGGGCTGCTCCCGATTTTCGCGTTGCTCAACAAGCGTGTTTTCAT
TGTGCACGGTGGCTTGAGTAACCACGAAAACGTAACCATCGGGGAGTTGCTACAGCTTGATCACAGACGTGAAATCCCAACGCAAGGTACGAGTCGAGCT
GATGAGGTTTTCACACATTTGCTATGGAGTGACCCGCGTGACGAAGATGGATGGAAGCCGTCAagccgaggtgctggcgtcgagtTCGGTCCTGATATAA
CGAAAGCCTTTTGCGCACAGAATGGAATCAGCCTCATTATTCGATCGCACGAGTGCCGAGAAGAAGGGTTCGACATCGTTCACGACGGTCTGCTTCTGAC
TGTTTTCTCAGCGTCAAGCTACTGCGGCTCCCAGACCAATAAGGGTGCCTACgtccagctggagctgggaGAAGACAACGAAATTAAGCCGCACGTTGTG
CAATTCTCCTCGCAGCCGCTCCAAAAACTGAAAGACGCAGGACGTAACGAGTGGCGCAAGAAAGCTCAGCGACTGGAGCGCAGAACTTTAATGTCCCTCG
TGGAAATAATttgcgagaagaagaactcgtTGCTGTCTGCTTTCAACGAGTTGGATATCACCGGTTCTGGACGCGTCACAAAGCTTGAGTGGAAGGCAAC
TCTGCAAAAAGTGCTGGGTATTGAGGCGAGATTCCTCTCGTACTTCCACCAACTTGCTGAGGAGGAGCATGATGGTGGAGTCGACTACCAGAAATTCCTC
AACCGCTACACGGTTGAGCTGGATGGTGGCAATGTGGAGTGGAGGCGTAACCTGATCCGCAAGGTCTGGATGGGATTCTGTCAAGCCCTTCCGCACCCGT
CCGAAACGGATGCACAAAAAATGACGTTGCAGGACAAACTACACTTTGCCTTCAATTTGTTCCAGTCGCCCTCGCCTGGAgctgccaagaaggagctaGC
AGCGACACCTGTCCCGAAGTCTGATGAAACCAGCGCACCTAGTACCCCCGTCAATGGTGCTAAACCCAAGGAGAGCTACCTGCACACTGGTCTGATCACG
TACGAGGTGTTCCGAAGCACCATCCAGGGTAAGCTGCAGCTAGGTGATACCCTTTCAGAGCAGCAGATCTTCGAGCTCATGCAGCACCTCGATCAGAATC
ACGACGGCGTGGTCGACTACCAGGAGTTTTGCTCATTCTTTGCCGAGTTCAGCCGCACGGATTATCTGCAAGAAATcttcgaggtggacgacACGAAGGC
GATTTCCCTCCTGAATCGTtgcgccacgctgctgcagagcccCAACAAATTCAAGACGTTGCGGGAAGCGTTCGACGCATTGGACCACAGCAGTACAGGA
AAGCTTACAGTGGACGATGTTTTGAAGGggacgcaggagctgaacATGGTGCCGGAGTTGGTTAACGAGGAGGCACAATTGCTGTTCAATTCGATCCTGC
TCAGCTACTACGGCATCAATCAGCGGCATCAGTGGGATACGCGAGGATTGGACTGGGTCGTGTTCGAGGACACGTTCTCGCCGGACAGCACCTTCCAGCG
GCGCCTGTGGCTGGCGAGTCTGGGTGCTTCAAATACGAACCTGGCCGCTCTCGACGCTCGCGACTCGTTCTCTggggacgacgacagcatcCAGGACGGA
CAGCTCTCGAAGAACCAGGCATGGGCGGACACGTTCGTCGACAGCGTGAAGCAATCGCtacacgagcagcgcctgTACATCAAGTTCCTGTTCCGGATAC
TGGACCGCAAGCGACACGGATACGTCACGAAGGAACAGTTCGTCGCTACGATGCAAGCCATCAATGAGGAGCATGGCGCGCCCCTGAAGCTCTCccagct
ggagcagctggccGACGCCTTCGCGCACCACAAGACCGTGCGTCGCATGTCGAGCGCGGGCGAAgtggcggaggagacgcgCACGTACGTCTCCTACCCC
GAGTTTCTGCGCAGCCTGCGCATCATCGACTC