Description :
From Genome Similarity Track
Location :
Scaffold_283:6431- 8843
Transcript NameFunction/comments
Phyta_totarag6650hypothetical protein
Phyta_totarag6651hypothetical protein PHYSODRAFT_503546
Phyta_totarag6652hypothetical protein PHYSODRAFT_502025

Sequence
2412 bases(100 bases per row)
GCAAACTCACACGTCTGGTAAGTCCACCGTTTGAAGGTCTGAAAAATAGTTTACTAACATTTCCTCTATTTGACTTCAGGATGATGTACGGCTACATCGA
GAGTATGTGGTTCCCTGTCTTCGCCTGCTTCCTGTACGGAGAAGGCTGCGCCGTTGTGTTCCTGTGTGCCTACACGTATTACTGCTCCGATAAACACTAC
GTGGCGCGCACTCTTGCTGTCTTCCTTACAGTTCTTACTCCCATTACCATCTACGTCATCGTCGGTGGTCTGGGCTACACAGGCCAGTCAACAAAGAGCG
TCGGCACGATTGTTGGCATCCTCGCTGACTGTGCCGGCATCTGCTTGTACGGCGCGCCCATGGAGAAATTGTTTCAAgtgctcaagcagaagtcagccgt
cttcatcaacgtGCACATGGTCATTGCTGGGCTGGCGAACAACTTGATCTGGCTCGTGTACGGCATCCTCATCACGAACTGGttcatcatctccatcaac
GTCCTCTTTGTCTCGGCCAACATGTTCACGCTGTGCTTGTACCGAGTCTACGACCCGAGGACACACCCGCTTCAAGATGGTTGGGACACACACGACGTTG
ACCAGGGCGACATCTCGGTCTGCATCGAGCTGACGCCTCGtatggagacgaagaagtcgCTCCCGAGTCTGCACAGCCCCGAATACTCGTACATGGAGTC
ACCAAGGCTCGAGAGTCTACGACAGTAGACGAACCTTACGGCGCGTAAGAACATCTGATCCTCAACTGTCCATGTAGACGTTATTCCGAACTTAATCAAT
TGTACATAGCCATGCAATTTTCGGTGCTCGACAGATCCATTTTTTGTGGTCTCAACTTCAATTATTATGGAACATATCCTGCACGCCAGTAGTCAGTGGT
CTGGTGACGTTGCGTCCACGATGTGGTCCACACCGTTCGCGTCTGCGTCCGCTCACTGGACAAATCTCATGTGGTTGGCCTCGATCAGGAGGTCCATCAC
AAcagcacctcctgctcgcgcttcCTCGTGTTCTCGCTTCGCCTCGCTACGTACTGTCGAAATGGCTTCCCCCGCTGAGCTCAAGTGGGTCGGTGCCCGT
CCCGACGacctgcaccaccacctgcgcgacggcgacgctgcGCTGGCCTGCACCGTGTCCCACGTGACGTCTCAGTTCGCACGCTGCATCGTGATGCCCA
ACCTGGTGCCGCCCGTGACGACTAcggagcaggcgctggcgTACCGCGAGCGCATCATCGCCCACGTGCCGGAGGAGAAGCACGATGCCAACAGCCCCAA
CGTTTTCGAGCCTCTGATGACGCTCTACATGACGGACGGCACGACGGCCGACGAGATCCGtcgcgccgccgccaccaacaaGATCGTCGCTGTCAAGCTG
TACCCTGGTACGTACGTACGTACACACGCGTGGAGTTAGAGAGGCAATGCAGACTTACTGACAGCTCTTGGTGTTGATgtgcagctggagcgacGACCAA
CTCGGACTCAGGTGTGACCAACATCGAGAACATCCACTCGGCGCTGGAAGCCATGAGCGAGGTTGGCATGCCGTTGCTGGTGCACGGCGAAGTGACCGAC
CCATCGGTGGATCTGTTCGACCGTGAGGCGACGTTTGTGGAGCACGTGATCAAGCCGCTGGTGGCCAAGTTCCcgcagctcaaggtggtGATGGAGCATA
TCACCACCAAGGAGGCTGCCGAGTTCGTCACGAACGCGCCTGCCAACGTCGCTGCCACCATCACGCCGCAGCACTTGCTCTACAACCGTAACGCCATTTT
CCAGGGTGGGCTGCGTCCGCACAAGTACTGCCTCCCGGTGCTAAAGCGAGAGACACACCGTCAGGCTCTGCTGCAGGCTATCGCTAGCGGTAGCAAGAAG
TTCTTCCTCGGTACAGACAGTGCTCCGCACGTGTCTTCCAAGAAGGAGTCTGGATGCGGTTGCGCCGGCATCTACTCGGCCCAcgctgcgcttgagctgT
ACGCCGAGGCCTTCGAGTCCATCGGCAAGCTGGACTTGCTCCGTGCGTTCGCGTGCGAGAACGGCGCCGACTTCTACGGCCTGAAGCGCAACACAGTGGG
CGAGACCGTCTTGAAGCAAGAGGAGTGGAAGGTGCCCGACAGCTACCCGTTTGACAACGGCGTCGTCGTGCCCCTGAAGGCTGGCGAGACCATccgctgg
aagctgcagcagtagACGCTTAACGTTACCATGCTTTCTGTCTTCGCTCTGCTGTCTAGGAAACAGACTGAGTAGTGGTTGTCTGTTCACGCGGGGGGCG
AAGAGAAATCCAAACTAGCGCGTTTTTCTCTAGTCTTCATCTCAAACACCGACTTCAAAATCCGACACGTTGGTTCATgtgttgttgatgatgttgaACT
GGGCGGGGAGGT