Description :
From Genome Similarity Track
Location :
Scaffold_322:6431- 8364
Transcript NameFunction/comments
Albla_Nc14119570DEAD/DEAH box RNA helicase putative

Sequence
1933 bases(100 bases per row)
GAACGCGATTTCGGACTCGACCAACGACTCATCAAAGCTACTCAGAAACTGAACTATACACACGCAACCCTCGTGCAAGTACACTGTATACCACTCGCCC
TCCAAGGAAAAGATCTGATCGTTCGAGCGCGTACCGGGTCCGGCAAAACCGCAGCATTCGCGTTGCCACTCCTCCACAAAATCCTCATGCATAAAGAATC
AGAAGCATCCTCAACTGGCTCCCGTAGCGTCACACAAGCCATCATTCTCGTTCCCACAAGAGAACTGGTCGATCAAGTCCGTGAGCAGCTCTGGAATCTG
ATGCATTACTGTCGCAATCGTATCTCTCTGCTTGCACTAACAGGCCAAAGCATGAGTATCCAGCAAGCACTTCTTCGTGACGCACCTGACATCCTCATTT
CCACGCCGGGTCGCATCGTATCGCACCTGGAAGCCGGTTATTTCGACCCAGCCAACATCCATAGTCTGATTATAGACGAAGCAGATCTGATTCTCTCTTT
TGGCTCGAAAAGTGATCTCTGTTCGATTTTTGACCACTTACCAAAAGCCATCCAGATCTTATGTATGTCAGCCACACTAAGTCCGGACTTGCGCGCTTTA
AAAAAAAGCGTATTCCATAATGCGGCAATCCTAAAACTCGAAGAGGAAGTCACTGATGGAAAGCTGCAGCAGTTTTATTTGCGCATTCCTCCAAAAGATA
AAGAATTGCTGTTATACGCACTACTCAAACTCGGGCTATTGCACGGGAAAATACTCTTTTTTGTAAATGTCACAGCCTCAGCGTACCGCCTCAAGCTGTT
CTTTGAGCAATTCCACATCAAAAGCGCTGTACTCAATGCCGAAATGCCTCACAACTCTCGAAAACACATTTTGCAAGAGTACAACCGCGGACTCTTTGAC
AACCTCATCGCCACCGACGAAAGTGTGGAAGCCGAAGATGAGGATGTCCCTCTCGATGATGAGGATGTCCCTCTCGATGATGAGGATGTGCCTCTCGAAG
TTGAGGATGTTCCTCAGGAGGACGAGTCCGATGAGGAGTCGAATGACGACCAACTCGGTGACGACTTTAACCACGACCAAAAGGTCCCAGAATCCACAAA
CAAATCGAGACAACAAGACGCACTTTACGGAGTGTCCCGAGGTGTCGATTTCTCCGGTGTCAAATTTGTCGTTAATGTCGACTTCCCTCAAAGTGCTCGC
TCTTACATCCATCGAATCGGTCGAACTGCTCGTGGAAATGAGTGTGGAACCGCATTGTCGATTGTCTCATCCGATTGCCAGAAGGAAGCCAAGACCCTCG
ACAAGCTTCAGGCCAAACAACAGCCTCTAATCACCCCATCCAACGATCTCATCAAACAACCTGCGCCACTATCCTTCGACCTTCACGAAATTGACCGCTT
CCGATATCGCGTGGAGGATGTCCAGCGAGCAGTGACCCGTATAGCTGTCCGAGAAGCCCAACTTGCCGATATCAAGAAAGAAATCTTAAATTCCGAGAAA
TTGGCCTCACACTTTGAGGCCAACCCGAGAGATTTGAATGTGCTTCAGCATGACAAAACCATTGGAAAAGCTCGAATTCAACCGCATTTGGCAACAATTC
CCGATTATCTTGTCCCTATCGGACTGCAGGTAGCGCCATCCAAACCCACACGAAAGAAACAGCGGACCACAAAAACGAACGGAAAACGTCGAACGGATAA
CGATCCTTTGCATTCCTTCACAGTATCGGAAGATACCCTATTGAACGAGCCGAAAGCGGTCCAGGAACCAGCAGAAGATCGAATCACATACGGGAATACC
GGCGTTGGAACCTCTACCGCAGGTCGTCAGAAATGGAAGCAATCGCATCGAAAGGGAAGATTCAATCGTCGAACTGCTGCGAAACAGAACGCGAAAAAAC
GAAAAGGATTCGCTCACTGATGAAATGAGATTT