Description :
From Genome Similarity Track
Location :
Scaffold_27:64306- 65745
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_07315protein phosphatase PP2A regulatory subunit B

Sequence
1439 bases(100 bases per row)
CGTACACGAACAAGCTGTTGCGCACAGCAACTGCGACCTCGTTCTGCGTCGGGTGCCACGTCGTCTGGAGCACTTTGGCCTTGTAGTCAAGCGGTTCGGC
CTCGGCGCCGGCCGCAAGCGCCCGCGCAATCGCATTGTGCGGCGCAGACGAGCGTCGTCGACCGGCGTGGACCATTGGATTGAGGCAGTAGTCCGACCGG
CCGTACCGGTCGTAAATGTGAAACTCGCTGTTGTACGAGCCCGTGATAAAGTTGTTGCCGTCGCCGCTCACGGAGCACTCAAACTTGTCAAAGATGCTGT
CCGTGTCGTAGAGCTCGCAGAGTCGCGGACGTAAATGCTCGTGGATCTATTGGTATCGCAGTGGGTTTTTTGTGCCAACGTAGAAATCACGTACGTTGAT
CGTCTGGACAGGTCGTGCCTCCATGTTGACATCCCAGATCTTGAGAGTGAGGTAGTCGCGCGAAATGATGTAGCGGCCGTCGGGCGAGAACTTAATGTCG
GAAATGGACGCGATGATTTCCGAGAAGAAGCTGCGCGACGCGGGGTCTTCCTGGTCCTCAAACACTATACAAGGCACGAACGCTATGAGCGGTCGTGCTG
CAAAAATGCGCGCGTAGTGTACGCCGGGAGTGCGAGTCGCAGAGCGCCGACGTGCGCATGTCGCCAAGCTTGACGGACCCGCGGCTCGTGCTGTACATCA
TGATGTTGCAGTGCGACGGATGGAAATCGGCAGCCGTAATGACCTCGGTGAGCTCCTCCATGTTGTTGGGCTTGATGTCGACAATGTCTGTCAAAAGACC
GTGGTCGATAAGGTGTCTAGGATATCGGACGCGAGCTTACTGAAGCTTTGGTTGGACACACCAAGGTGCCACAGGTTGATGCGCAGGTCGTCGGCCGATA
GAAAGGTTTCGCCGTCACTGTTGAGCGCGATCGAGTTGATGTGGTACGTGTGGGCGTTGGCAAAAACGCGCTTGGGCGTCGCAACCGCCACCGTGTCGGT
GACGCTCATGGTCGGGAACATGATGCGCTCGCCATACGTCATGTTGGCGCGCTGCGTGCTACGCACGTGGCGGTCGTGCAGCTTCCAGAACTTGATCGTC
TTGTCGTTCGTCGAGAGCAAGTAGAGTGCATTGTTCGACGCCCGGCACCACTTGATCTTGTTGACTTTCTCTTCGATCTCCAAGCTCTTCAAGTAGTCAA
ACTCGGGCGTATGGCTCTGGAACGTCTTGTAGTTGGCGTACTTGGAGGGCTCTTGCGATTGGAACGACCGGCGAAGCTTTTCCTTCTGCGGATCGCGTGA
GCTCGGTGGTGGCCGCCAGGTGTACCTTATGGGCGCCGCCTTCCTTGGAGTAGACGATGACTTGGCCACCCTTGGTACCAGTCGCAAGGTACTCGCCGGA
CCGATCATACTCGATGGCCGTGATCGTGTCGACTACAGA