Description :
From Genome Similarity Track
Location :
Scaffold_27:64305- 65740
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_07315protein phosphatase PP2A regulatory subunit B

Sequence
1435 bases(100 bases per row)
GCGTACACGAACAAGCTGTTGCGCACAGCAACTGCGACCTCGTTCTGCGTCGGGTGCCACGTCGTCTGGAGCACTTTGGCCTTGTAGTCAAGCGGTTCGG
CCTCGGCGCCGGCCGCAAGCGCCCGCGCAATCGCATTGTGCGGCGCAGACGAGCGTCGTCGACCGGCGTGGACCATTGGATTGAGGCAGTAGTCCGACCG
GCCGTACCGGTCGTAAATGTGAAACTCGCTGTTGTACGAGCCCGTGATAAAGTTGTTGCCGTCGCCGCTCACGGAGCACTCAAACTTGTCAAAGATGCTG
TCCGTGTCGTAGAGCTCGCAGAGTCGCGGACGTAAATGCTCGTGGATCTATTGGTATCGCAGTGGGTTTTTTGTGCCAACGTAGAAATCACGTACGTTGA
TCGTCTGGACAGGTCGTGCCTCCATGTTGACATCCCAGATCTTGAGAGTGAGGTAGTCGCGCGAAATGATGTAGCGGCCGTCGGGCGAGAACTTAATGTC
GGAAATGGACGCGATGATTTCCGAGAAGAAGCTGCGCGACGCGGGGTCTTCCTGGTCCTCAAACACTATACAAGGCACGAACGCTATGAGCGGTCGTGCT
GCAAAAATGCGCGCGTAGTGTACGCCGGGAGTGCGAGTCGCAGAGCGCCGACGTGCGCATGTCGCCAAGCTTGACGGACCCGCGGCTCGTGCTGTACATC
ATGATGTTGCAGTGCGACGGATGGAAATCGGCAGCCGTAATGACCTCGGTGAGCTCCTCCATGTTGTTGGGCTTGATGTCGACAATGTCTGTCAAAAGAC
CGTGGTCGATAAGGTGTCTAGGATATCGGACGCGAGCTTACTGAAGCTTTGGTTGGACACACCAAGGTGCCACAGGTTGATGCGCAGGTCGTCGGCCGAT
AGAAAGGTTTCGCCGTCACTGTTGAGCGCGATCGAGTTGATGTGGTACGTGTGGGCGTTGGCAAAAACGCGCTTGGGCGTCGCAACCGCCACCGTGTCGG
TGACGCTCATGGTCGGGAACATGATGCGCTCGCCATACGTCATGTTGGCGCGCTGCGTGCTACGCACGTGGCGGTCGTGCAGCTTCCAGAACTTGATCGT
CTTGTCGTTCGTCGAGAGCAAGTAGAGTGCATTGTTCGACGCCCGGCACCACTTGATCTTGTTGACTTTCTCTTCGATCTCCAAGCTCTTCAAGTAGTCA
AACTCGGGCGTATGGCTCTGGAACGTCTTGTAGTTGGCGTACTTGGAGGGCTCTTGCGATTGGAACGACCGGCGAAGCTTTTCCTTCTGCGGATCGCGTG
AGCTCGGTGGTGGCCGCCAGGTGTACCTTATGGGCGCCGCCTTCCTTGGAGTAGACGATGACTTGGCCACCCTTGGTACCAGTCGCAAGGTACTCGCCGG
ACCGATCATACTCGATGGCCGTGATCGTGTCGACT