Description :
From Genome Similarity Track
Location :
Scaffold_3629:643- 2225
Sequence
1582 bases(100 bases per row)
AAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTTGATGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACAAAGGAGAGAGGCACGTG
GTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGAGTGAGGTCACTGCGGATCCCCCTAAGATCTGTCAGGTCACTGGATCCCGTGG
ATCTGAGGATGTTGGATCCATGGATCTGCTAACAGAGAGAGTCCGCGTGAGTACTGGGAGAGTAACATGCCCGGGGAAGGTGGTTTCAGTACAGCCCGAG
GTGAGGGGGCAGAGATTCAAACATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGT
GCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTG
TTTAGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTG
GCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTACGGAGCGAAGATGAGGATCATAAGGGCGGATAAAA
CGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGCGAGAAGTGGGTGCC
TACCGTAATCCAAGGACCAGGTCGATCACAATACCCCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGG
TTGGCGAAGGACGGTATCCCTAGGCGACCTGGATACGTGTCAGTGGGATCCAGCCGTTACAGAAAATGGCAGAATCTGGCGTACGAGGCGACTACCGAAA
TCGAATCTTTCGGAGAGGTGAAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCG
ACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAG
AGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGTGTGTTGAAATTTGCGTACTACCCGGGATTGCTTGCCCCCATCAAGGTTA
TCTCCGATCACTTATCCCACAGTCACGGGCCGTGAGGCCCGGAGCGGTTTTAGTTTGCAAATTGTGCAGTCGAATCTTCAGGGTTGGGCCCCCGGATAGT
ACTGTAGCTTGAGGTGCGATATCCTTTTGCCAAAAAGGCGGCCGTTAATTGCAAAGGCTGGGTATTGATAGGCTATTACAGCCCCCATCCCATCTGTCGG
TTAAAAGAGGCCAGTTACGGTACCCCTCCTGACCAACTGCACGCACGCAATGTGCGTGCCCATCAATAACCATTACGGACCC