Description :
From Genome Similarity Track
Location :
Scaffold_419:64296- 73433
Transcript NameFunction/comments
Aphin_H310_00849beta-glucosidase
Aphin_H310_00850pleckstrin domain-containing protein

Sequence
9137 bases(100 bases per row)
TTGGTGGGCACTGCTCCCAACGTTGTATCGTCAACTGGCGTGACAGGAGTTAGCCCACCCAACTACAGGAGTCAGAGCATCCCGTTCACGGCCAACTCAG
TCGTCCTCACCGGTCTGACCCCAGGGACTCCGTATTTCGTGTACGTCAAAGCTGCCAACGACCGAGGTTACGGCATGTATGGTGTTCCGTCACCGCCGTC
GTACACCCCAATTGGCATTCCTGACATGTTGGAAAATGTGTGGCTACGATCGCTCAGTCAAACTCAAGTCGAGTTAACCTATGACGAAGTGGATGTGTCT
GGTGGAGCTGCCGTGGACAAATATTTGGTCGAATATGGCAACGACCCAACTTTCCAGGTCGCGACGGCGCTCCCTCCCCTTTTGCCCCAGAACAAATTTG
TGCGCGTGACCACTGCCGCTGCGCTTGGACCAATCGACCCCACGAGCTTTTTCACGCTGTCGCTGTCAAATTACTATGGCATGTTCAACGTGGACCTCGG
GGGGTATTTCAACCTGCTCACGAACAGCTTTTTCATCACTCAAGCGAACCCTGTTGGCGTTGCCGCGGTGGATTTGACCAAACTGGTCGCCCGGGGGGAA
TTTATCAAGATTGCAAACGAAGAATATCGAGTTTGTTTGGACCCAACCACGTCGTACGCTGTGCCGGGAGTGACAGTGACGCAATTCGACTTTGGGGCCA
ATATCATGACTGTGACGCCAGCGCTAAACAACCATCTTGTTCTTGTGGTTGGAACAAGCATTGTTGTCCGCGACTGTTTGATGGTTATCACGGGACTTCC
CACAGCGACGACGATCTCTGTGTCGCACCAGTGTTTCGCCAACTTTGGTCCCGGGGCGACGGATCCGCTCTACGTGCGTTGGGGGCCAAGTGCCATCCCG
ATCTGCTCCAAGACGAATCCGTGGGCGATCGCAACGTACACGGGGTACTCCATCTTAGAAATGCCACTTTTCAAGTTGGACACCGCGCTTGGTCCATTCA
CCAACTTGGACGCGGCTCTTGCGTCGGGCAATGCGCTACAAGGACAATGGAATGACGTTGGTAGCACTCTAAACACGATCTCAAGCTTAGGGTGCAGGGA
CTACTTCCGTCTTGGAGATCCCTACACCGGACAAATCGCACGGGTATGGACGCCATGTGTGGGTACGACGTGCGCCTGCGCTGGCCTCACAGCGTCCGTC
CTACCACTCGGCGACATCGCTTCGCCGCATCTGGCGTCCAGTCTCTCATACGAGACGTTGCAATATGCGACCCAAGAAATCCAAACGATCCGCATTTCGA
CAGGAGCAGGCGATTTTACCACAGGTGTCGGTGGTTTCCGACTTCAATTTGGAGCGGATGTGACCGCCACAACGTTGGTCGGCGGTAATGGTGGTGCCAA
CGTGAATGCCCAGTACGGCTGTCTCTTGTGGGCATCGGGGGTGACAGCGCAAGCCGCGCTGGCCGACAGCGCTGCTCTCAAAGCCGAGTTGGAAACGTTG
CCGTCGATCGATCAAGTCCAAGTCAGCCGCACGCTGTATTTGAACCCAACCGTGGCTGTGTACACCATTACGTTCACGGGTGTTCGTGTCCGAGGGAAAT
TGCCCACATTGCAAGTTGTCGACCAGGGATCGAACGGTTGTGGGGCGTTCACGGGTGCCACTCCGGTCGCGCCAGTCGTCAACAAGATTCAAAACTCGTA
CGTGAACGCGTATCGACTCGAAAAATCCAGCGATATCCCTGTCACAGCGACTGCGCAAGATGTCAAAGCTGCGATTGAGCAGCTGTCACTGTCATGCAAG
GTGGACGTCTCGCGGACGGTGGCCAAGAACGGGTTCCACTGGTTCGTTACGTTCACGCAAGGCGTCCCTGTGCATTTGCTCACGTTTAACTCCAACGACT
ACAAGTTGCGCGCGACGTTGGCTCCCTTGGCAACAGTCACGCGGATGAATCAAGTCAAGTTGAACGTTCTTAACAACGGCCAAAGCGTGTACGCGCGTGT
GGCGGCGCACAATGTCGCTGGATCTGGCGTCCTGACTATTCCTACGCCGACGTCGGTGCAGGCGACACACCACGTTCCTGGTCTTGTGTCGAACCTTCGT
GTGGACGTGGTGTCGGACACGCAGCTCCTCGTGCAGTGGCAAGACCCCGTCGACACCGGGGGACAAAACGTCACGAAATTCAATGTCGAATGGTACACCG
GCGCGACCAAGGGCAATCAAGTGGTCAAGTGGACGGATTCCACTGGGATGAATGACGTCGAAGTCATTTCCGTGTCGGCGCCGTCAGTTGGCGCCTTTCC
TTACTTGGACGGGACGTTCCAATTGATGTTTGACAACCAAGTGACGGACGAGCTTCCTTTTGACATTTCGGCGATCAAGCTCCAAGAAGCGCTCCAAGCA
CTCTGCACGATCGATGCAGTGGAGGTTACCCGTGAATTGGGACCCAACGTAAGCAGCCGCGGTCGGCTCGTACATTGCATGTGTCTGACTGGATTCTGCT
AGGGCTATACGTGGCTAGTGACGTTTGCCCAAGTCATGTACGCGGGCAATCAGTTCACTCAGTACGCGTCGTTGCTTCAAACTCAGGTCGGTCATCGGTT
GTCCGTCTTGAGCAACAATCTGTTGATGTGTTCGGACATTGCTCGAACGAATTGCAAACGGGAGACTGTCAACGGCGCCCAAGTGATCTCGCCCACGGCA
GCGACGGGGGCAGTCCCCGAGGTCCAGACTGTACTGTGTACGGCAGGACCTGGTCGATCCTTCCAGCTCAACTACATGGGCTACACGACGACGTCGATTT
CATCCACAGCAACGTTGGCTCAAGTCACGTCAGCCATCGCAAGCCTGCCGTTTGTCCAAGCAAGTGTATCGTTCAGCAATGGCCAAGGCAGTGTTTGTGA
TGCCACAACCCCCCAAGCTGTGCGAATACAATTCAACTCGGAGATGGGCGACATACCATTGCTCACGGCTTCGGGTGCAGACGTCGGAGTGACTGTGACG
ATAGCCCTGTCGGAAACCACCAAGGGTCGGTTCCACCACCGAATTGGACTCGCGCCTCGCTCGTACTTGATATCAGGCCTGACCCCATCGGTTGCGTACA
ATGTGCGCGTCGCTGCGTATAACAACGTCGGCTACGGTGCATTCGTCCCCGCACTGACCACGTATATTCCCGTGCCGAGAGGTCCCATGGCACCAGCGTC
AGTGCAAATCATGGGGCAAACGGCGGCATCGTTTGGCGTGGTGTGGGAAGAGCCCGTCAGCGACGGTGGCAGCACAGTCACCGACTACACGGTCGAATGG
GACCACACGAGGACGTTCCGCAGCAGTTGCGGAGACAACGCCGAAGTTCAGTACCTTTCCGTCCAAGGAGTGCCTCCCCTGGTCGGAACGCAACAATTTC
AGTTGGCAATTGGCACGACCGTCGTGGGATGCGTAAACTGGGGCATCTCGGCGACAGATCTGCAAACGCTGGTTCGGTCCGTCGCACGATACAGTGCCGT
CACGGTCGTCCAGCACGGTGATGATTCGGCCGAGTGGAATTACGGCCACATGTACGAGTTTACCTTCTACGCGCCGTTGACGACGGCACCATTGGAAAAC
GTGCCGACCATGGTGGCCACCCTTGTCGCGGGATGCAACAGCTTTACTGGTGGCACCATATCCGTCACGACAAAGACATTTGGACCAGGGTTGGACGACC
TTCATGGTGTCGGCCGCCAAACTACCACCGACAACGCATGCAACGCATTGTATTTGAAGCCTGTTGGACGGAAGACGACATCCGACGCGACGGCGAAAGC
CGCAGCTCTCGCTCTGCACGTACCTCCCGGTACAACCCTCCACCCGTTCTGTGCCTCGTGTGCACAGACCCTCACGGGCACCACCGTGGCCGTCACTACC
GACTTGACAGCACTACTCTTTGTCGGCGATGTGTTTTCGATTGGACAAACCAAGTGCGTGTACACGGTGCAAGCGATCACAGTGTCGTCGATTACAGTGG
GTCCTGGTGAATTGTGCCCAGCCTTTACGGGCCAAGCCCTTCCGATTTATCGTTATTCGATGCGGGCGTACGTCGTTCAAGACGTCGAGCCTGGAACGCC
GTTCTACGTGCGTGTCGCGGCGCAAAACGCGATCGCAACCGGGCCGGCGACGTACAGCTACTAGGCGGCTCGCTGTATATAAATATGCATCATATTCGTG
TTTGACGAGACTTGCGCGACTACAAATTGGGAGGAAGGACGCAATTGCGCTGGACGTTGGCGCACTTGTCGCAAACACGGTCGCGCTTGGAGCTCCCTGT
TGTCAGCACCATTCGCGTCCTGGAGCACTTGCCGCACACTTGGTTTCCGCAACGCCTGTCGGATGAGCGTGACAATCGCACGACGGGACAAGTTACGTCG
TACTTGCAGTGGTGCCTGGTGCGATGAAAGGCAAACTTGTTGAGGCACAACGTACAGCTCTAGCATTCCCCGAGTCAGCAATGCCTTCGAGTAGTTTGCT
CGGGCTTCACCTTGGCCGCGCCAAACATGTAAATTGGCGCGTACCCAGAGCTAGGCTCTGACACCCTTGAGCTGCACGACATGACGTCTCCACCAGACGC
AGTGCATAGAACGCAATGGTCGATGGCACGAATCCATTCGTCTCGGTCCAGATGAGCTTCCAACGTGAATTCTTTCGACATGGCTCCAATGTCATCCTAG
GAGTCGCCGTGAAAGGCCATTGTCCCCAACGTCGTTCGAACACACCTCGAGCATATCTTCTCCACGGATCATGAAGGTGCTTGCGTTGTCGGACACGATC
TCAACATCGCAGCTTGAAATGACGAGCTGCACTTCAGGATTTGCTTGGAACGACGAAGCCAACGTCACATGCTGATAGTCCACCGTTACCCACATCCGCT
TCCACTTGTGTCCTCGTTGAACAGGCAGCCAGCCCGATTTGATGATAATCTCCACGTCGTTGGCAGCATCCTCGTCCACGGATGATACGGAAAGTCTTGC
CGTCGATTCCGCTCGCGAGATCACGTCCTACATCATCAAAATGTGACGGATCGATCGATGGATATCCCGAAGACCCTTTTGGACTTGTACCTGCAGGACG
GACAACCACCCATCTTGTTCTGCCGTCGACTCGGCAATGAGTAAAAACGACTTTTGGCTCGACAGGAACTTGAAGGCACTGCAACGACATAACGTCATGC
GCAATACGGAGAGGGAATTGGTTGCGTACTTGTTGTGATTCATGTTGGTCGCAAGAACGCTGCGAATGCTGTCGGTGAGGGAGTCCACTGGCGACACGGA
GCACCCGTTCAAGTCGATGACCTTGTGCTTGCGCTGGTATGTGGCCATCCAGTCCGTCGGTGCGTACAGCAGTGCTGTCAGGACAAGTTGTCCATCATAC
CATTTGAAATGGACGAGCTCTTACCATTGGTGAATAGCACGATGTGGTATACTTTGACCGAGTTGCGGCACACTTTTCGCAGCAACCCTTCCTTGACGAA
CTGGCGGTCTTTGTCGGGGGGCAACCCGTACTTAAACTCCACTTGGCGGAGCTTTCGCGTACTCTCGCGGGCTTCGACTGTGTCTCGAATAATCTGAACG
ACACGATGGATGGCGGCAATCGCCGACATCAACGGCTTGTAGTCCATGTGCGCTTCACTCGTCCACGGTTTGAGCTCGGCCAAATACAGGCTGTACTTGG
GAATGCGCTCGATTGGCATGTTGAGGAACGTGCGCAACTGGTGCAGCGTCGTGGCGTTCATCGGGAGTTGAATCTCGGCCAGCATCGACACGAATCGATC
CGACTACAACCAGGTCGTCATCGATTTGTGCATGGTCAAGTGGGTCCTGTACTTCGATGGCAGCCAGCGCCGACTCGTGGTGGCACGCATACGACGAATA
CAATTGAAACAGTGGCGCGTACGCGTTGAAAATTGCTCCCTGCAAAGGTTTCGTGTGAGAGCAGATACATGTCCCGTCGTACCACAAGGTGGATGGCCAC
GCTGCCATTTTCAATCTCCTTCAAATGATGCGTGAGGTGGTCCAGGAACTGTTGGTTCAGCGTGTAGATCTGCCCCATGCTACAGCTTGAATGAAGCCAC
AGCACCAGAAGTCTTGCACGTGCCTCGTGAAAAAGATCGACATGTCCGCGTCCAGGAGCGTCTTCTTCGTGCAGTTGTCATGTAGCACGCTGCTAACGAG
TCCGGTTTGGACGCTTGCCCCACCTACGTAGCCGCAGTGCCATCAGGATTCGGTCGTGGGTGATATTGTAGGTGAAATCCTTACGTCGGTTGAGTCCCAA
CATCGTCAACCTCTGCTTCAATTGCTCGTGCTTTTTCAGCGACATTTGAGACAACCGTCTCTGCAAGCTGAGCTTGCTGTTGACCTCGACGCTGCGTTTC
CGCTCGACTTCGCGCAGCATCAACGGCTGGACAAACATGCGAATGCAAGTGCCCAAGCACTCGACGTAGCTCTGCTCCTATCATATCCCCATCGTTCACG
TGAAGACATTACACGCAACAGTGCTCTACCGAGCGAACGATTTCCGTCAAAATCTTGTGCCGAAACCCTTCGGCTTTTTGATCGTCATACACCAAAAAGT
CGAGCTGCTTTAGGTCTATGGGATCTGCTACGAAAACGACGACGCATGTCCACCAGAAGATGAGTTGGGTGGTCGCAGCCACTACTCGCTTCCTTGTCCT
TCGGACATGGCACGAGGAACAATGCACACGTACTCTGTTCGGGATCGGAGTGGATATTGACGTCGCCGTCGAACGACTTCGATCGAATAGTTGACGTGCG
CTTTAGAGCTTTGTTAGCCGACTCTTCGATCGCCTTGGTCCATTCTGCCAGTCCGTCGGGCGAGTAAGCGCATAGAAGCCACTCTTGATTGTCCCATCGA
CAGCTCATTTTGTCTTGCCGTCTCGACTTGAGAGGGGACAGCCTCGACATGGACGACGGTGCCGACACGATCTCGGCCGCGAACGTTGTCGAGATTTGAA
AGCAGTACAGGGACCGTCTACAGTTGTCCGTGACATGACGAGTTGCACGGACTACGCACTGGTCCCGTCGACGCACGACGATTGCACCGGCCAAATTAAG
CGTCTGAATCACTGCGCCGCCATGATACTGCCGCAACACCCCGCCCTTGATGTCAAACTCGTACTCACTCCACTACAACACCGTCGAACCGCATCACGGA
CTGCCCCAATGGTCCGTCAGACACGCCTTGTACCTTGTTCTTGCGATCTCGACGCAGGAGCGTCCGCTTCTTAAACTCGATGAGGCACCCGAGCCAAGTG
AGGGCACTCTGTTTGACCAAGTCGAGCACGCGGTTGCATTTATTGCACACTCGGACGGGCCGCATGTCGTTGTCGAACAGGATGGAACGGTGTTCCGAAC
ACAGTCCGCACACGACAAAGCCGCACCGTCTACGCGACCAACCGTCGGCCTTGACCACCTCGCATGCGCTTGCAACGTTGAGGGGGCCACGCACCTGCAG
TGGTGGCGCCGCAAGAGCAGTCGAAATGCCTTTCTGCATTGACTGCATTCTTCCGACACGCTGTCAGGGATCCAGACGGCGGCCGGGGCGGAGTCGACTG
CTGTCGTCGAATCCTTGGCCTGCGTCTCCGTGATGAGGCGGCCGATCGTGGACACCCACGCTTGTTTGTCCTGAACGGTTGGAGCAAACAGCACAAACGA
CTTTTGCGCGCTCGACATCTACCACACGAGAAAAAGAGGTGTCCATGAACATGGTTGCATTGGCAGCATCCATTGCGATGGACGCACCATGAAGCCACAC
TCAAGCGTGTCTGCGCCAAACAGATTCACGTATGACGACGGGACTGTCCCATCGACGCGGCACGCTTTCGAATGAAAGTCCACGATCCGGCGCGCATGGA
ACGTCTCGGCGGACAGGATGTCGCTGTACATGAGGAGATCGTTGAAAAGGTGCACCATCACCTTGTCTTCGCGTTTGGTGGACATCTAAACACTGTGTTA
TCTCCTTCCAAGATCGTCATGCACGGGATCGATGGAAGCCAAACCTTGACCAGCATGCCGGATCGGACGCAGTGTCGGTTGAGCGCAAACAGCGACACTT
GGCCCGCGAACTGCGCCTGGATCCGCAGGACTTCCTCCGTCTTTTCTTTCTGGCGCAGGGTTTCGTCCATGCGCTGGGCCGCTTCGCCCATCGCTTGCAC
AGTCTACCACCATACCACACACGAATCACCAAAATGTTTTGGAGCTGCGATCGAACCACGTACGAGCTTCAGCGATGCCAAGTCGGGATGGTCCTCGCGA
GTGTGTTTTACGACCCGCTACGGCCGTGCCACATGTCGGCCGTCGTGGACGCGACGTCTTTCGTACCTGGAGCAACAGGTTGTACCGGGGAATCCGTTGA
ATCGGCAGGATGAGCAAGCTCTCAAAGGTTTGGTTCGAACCGCCTTTTCGCTGACATTGCTACAAGCATCACAACACTCAAGGAAGGTGCAGAGAGGGAA
ATGGGACGGCGGTGGGTACGTCGAGGAGCGTCGAGAATCCCTTGGATTGGGTCTTGTACTCGTTCAAGAGCGGTGTAAAGTCGTCGAAGTATTTGGCATA
TTCCGAGTAGAACGACGTAAAGAGGGGGATGTACTGGTTGAACAGCACCACGATGCGCTCAGTCGAGTTTTGTCCATGCTCTCTCTGAAGCGTCACTTGC
ATGAGCTCTTCGAGAAAGGTCGAGTTGAGCTTCACGAGCTCTTGCAGCGTGTTGAAGAAGACCTGCGGGGACTCGTGAGCCCGACACAACTGTCAACGAT
CGACAACTTACGGCCACGGCTGAGTTGGTCATCATGGGGTGTTTCGCCTCCTGCAATGGCTTGACGAACGATTCGACGAGCGTCACGAGGTTCTTGACGT
ATGTGGCCTCTGTCGAGCACATTTCGTCGACGACCAGGTCAAGGATGCCATGTTGTTCTGCCGCAGGCCCCACAAGGCTGGCGTTTCCAAGACCTGCATC
TGTACTCTGGAATCGCTCTCGCTCATCGCTGTCTTGCCGAGCAAGTGCCCTCGCGTGGGCCACCAACGTCTTGGCCGTTCGAGAAGACTGCGAGGCTGTG
TGCATGAGGGACGGCGTAGGTTGTACGTCTGCTGCCG