Description :
From Genome Similarity Track
Location :
scaffold_60:64263- 67179
Transcript NameFunction/comments
g2423.t1 hypothetical protein PHYSODRAFT_329641
g2424.t1 hypothetical protein PHYSODRAFT_313793

Sequence
2916 bases(100 bases per row)
TCGATGGCTTTGGTGCTGTTTCTCGTGCTCTAGCGGCGCTTTCGATCATGCCTGAGACGATCAAGAGTCCACCAGCTCGACTGACCACTGCACCCGATGC
GGTAGCTACCTTTGAACGCGACTCTGTGTACATGCAGGGTCGATACCTCAAATTCCAGCGCGGGCTGAGCCAGACACCATGGGTTCTGGACGGCGAACGA
ATGGGTGAATCCTCGGTGGAAGAATGCATTGGGGATATCGCTCTGCCTTTCTTTCGAGGTGCAGGCTACAAGTTCCACACTGCAGGTCGTGAAGATGTTG
ATGTGCGCATGCTTGGAAACGGAAGGCCGTTCATTTTAGAGATTTTGGGTGCGGGTCAACTCTACAGCATTGAACTATTGTGTGGTGTAGAATTTTTTTA
GCTGGTAGCTCCTCACCTCCTAATTGTTTCTACTTGTAGATGCCAAGAAAGCATATCTGGACCAATCCGACTATGCCCAGATTCAAAAGGCGGTGAATGA
TGCAAACAATGGCGCTGTTGAAATCGTCCAAGTCAAGAGTTCGACGAAGGATTACTTTGCGGGGCTACAGGCTGGCGCTGACTCAAAGAAGAAGACGTAC
TGGTACGATTCATTACTGTCACTAAGACTCGGTCTACTGTTTAACGAGGTATTTCATTTACGGCTATTAGCTGCGTTGTTTGGTCGGAAGGAGTTTTGAC
ACCCGAGGCTATCGCGAAGATTGATGCGATTCACGACCTCACCATTCAGCAGCAAACTCCTATCCGTGTGCTGCATCGCCGAACGCTCATGACGCGACCG
AAGATTATTCATGCTGCCAAGTGCGAGGTGTTGAACAATCACTACATGCTGCTGCGTCTCACAACTTCTGCTGGCACGTATGTCAAGGAGTTTGTGCACG
GAGATCGAGGCCGAACCAACCCCAACGTCGCTTCAATCTTGGTACGTAGGAAGCTGTAAGTGATGTGTTTATGTCTATAGGCTGCTGACACAATCTTGTG
CTGGTTGTTATTGTAGGGCTGTGATGCTGACATCATTCAACTGGACGTTGAAAGCCTCATCGACGCTCAGTAAATACAACGGCGTTACGGACCAGCATAG
TGTTCCCAACTCAATACATAGAGATAGTTCTATTGATTCATCTTCAAGCTCACATCTACTCGTCGGTTAGTTCAGGAAAAGCCAAGGACTCGTACTGAGA
CTCATCCCACAGCTCTCCAATCTGATGGAGTAGTTCCTGGGCTGCTTGTGGGAGTGCTGTGGCAACACGTTGCTCGTTGTTCTCCTGTGCCTCAGCTGCT
GCACGAATCTCCTTCGCCGCTACCGCTGACGAAGATGTCTGCAGCAGATTAAGCACGCCTTTCGTGTTCGTGTTCATGCTGCTTTGAGCGTCACTCTTCT
GCACAACCGTAGCCGCAACCTTTTCCTTGAACTCTTGGAGGTTCATTATGTGCTCCTCGAGCGATTCCTCCATGATCAAGCGAAAGACCCGAACAGTTCG
CTTCTGGCCAATACGGTGAGCTCGATCCATTGCCTGCAGATCGACAAACGGGTTCCAAGAATGCTCGATAAAAATGACCGTGTCAGCTCCGGTGAGAGTG
AGTCCGAGTCCGCCAACTGAAGTAGTCAACAACAAGACATCGATCGATGGATCAGCATTAAAGTGCTGCACGACGTCTGCACGCTTGGCATGAGGTGTTT
GTCCATCGAGGCGACGATAAGTTACTGCAGGTAATGCATCCTGAAGCATTTGCTCCGTGAGGTCCAGTGTCTTCTGCAGATGAGCAAATACCAAACATCG
ATGGGGAGAAATGCTGCTGTCGTCCACATTGTCGGCACTTTGACGGGCCCCTTGATCCCAGGCCGCGATATCGCAGCACTCTACCAAAAGATCTCGCAAT
CCGGTCATTTTACCCGAGCTCTTCCAGTCGCGAAGTGCTCCCTTCTCCTTGCGATTTAAACTGCTTGTCACCACGTTGTCAGCAACCAGCGCTGGGTGTA
CACAAATCTTCCGAAGCAATTGCAGGTTCGTCAGCACATTGGTGAATGGCTTCGCATCCGTGTTATTTCCACGCAGCTTCGACTTCGTGCCCACGGTTCT
TACATCATTTGACGATGTCAGTGAGTAAAGTCGTTTCTGCAGCGGAGACAGGGGCAGCAACACATTGGAGATGATTTTTGGAGGCAGTTCTTCCAACACC
TGGTCTTTCGTTCGCCGGAGAATGAACGGCAACACTTTCTGATGGAGTTTTGTGATAGCGATGGCTGCCAGTTCTTTCTGCTTCGGTGTTGCGTTCCTCT
CTTTCGACTTTGTGATCGGAAGGACAAACTCGCGACGAAACATTGTGAAATCGCCTAAGTATCCAGGCATCAGGAACTCGAACAGAGCCCACAAGTCAGT
GACGTTATTCTGCAACGGTGTACCACTTAAGGCAACACGATGTGATGCCCGAAGCTCCAATACAGCACGAAAAAGCGCCGTAAACGGGTTCCGGATCAAA
TGGGCCTCGTCAAGCACAACAAAAGAATAGTCCATCGTGCCCAAGAGCTCGATATCGCTACGTAAGATTGAATATGTCGTCACGATCAAGGTCAATCCGC
AAGCTGAAGGGAGAATACCCTTCCCGTGATTCAAAGCCTTCCGTTCACTTGCAGGCAGCGAATAGTCGATGATGGACTCGAATACACCTGGGATGTACTT
ATTGACCTCCTGTATCCAGTGATGAACGATTATTGGTGGACACACAATAAGACAAGGCCTTGCTGTATCACTTTCCCTTCCAGGTGGCATTCCCAGGGTG
GCCGCGATCGCGGAAAGTGACTGTAAAGTTTTGCCAAGGCCCATATCATCAGCGAGAATCCCGTGGAGATTGTTCTTGGCCATAAAGCACAACCAGTCCA
CGCCATGCTGCTGGTA