Description :
From Genome Similarity Track
Location :
Scaffold_13:64263- 66461
Transcript NameFunction/comments
Aphas_H257_05669acetyl-CoA carboxylase

Sequence
2198 bases(100 bases per row)
TAGGTCGAGCACCCTGTCACAGAACTCATCACGAAAGTGGACTTGGTCGAGCAAATGCTTCGCATTGCGGCGGGTCATGCTCTGCCTGCGCACTTGACGT
CTGGCCCGTTGCCGATCTACGGTAACTTGATAAATCTGTTAACTGTCTAGTTAATTGGTAGTTTTAACACTGTATTTAGGATGGGCGATGGAAAGCCGCG
TGTATGCCGAAGACCCCCTCCGCGGATTCCTCCCCTCCATCGGGCGGTTGCTCACTTATGACGAGCCGCACCATCTGCCCGGCGTCCGCGTCGACTCGGG
CGTGACGGAAGGCAGCGACATTAGCATGCACTACGACCCGATGATTTCCAAGCTCGTGACCCATGGCAAGGTATGTTGTGCACTTCTTCTTTCTGTATAT
ATATATATATATCTTGTCTTTTTTCGCTGACATTTGGACTTGTTCGAGAATATATATCGATGTGTGTCTAGTTGACCTTCTATTCAATGTACTAGTATTA
TATTATTGTATACAATAATGATTGTTGTTGATTGGTTCAATCAGCTCTGTCCATCGTATCCTTTGATTGGCTGGGACATTCTAAACACAACATTGGCCGA
ATAATTCGAATTTGACCATATAAATATATATATGTAGGACCGCAAAGAGTGTCTTGAACGCATGAAGTTTGCGCTGGACCACTATGTGATTCGCGGCCCG
GGCAACAACATGGCGTTCATGCAAGACGTGTACCGGCACCCTCGGTTCGAGTCTGGCAACATCACGACCAAATTCATCGCGGAAGAGTACCCCGACGGCT
TCACGGGCGTCAAACTCGACGCGGAGCAGACCCACGAGGTGATCGTCGCCGGCGCGCTCATGCACCTCAAGGCGTCGCGGTCCTCCAACAAGAACAAGGC
GGCGCAAGTGTGGACGACCGCCGCCGGCACCACCGTGACCCAACTGCCCGAGTCGTTTCAAGGAGGTAGGTACAAAGCAATATTCGCCAATATTTTCATT
ATTTAACTCAAATATTTGGACTTTTTTGCTGACTCGCCAAATATCGATCCTTCCTTGTATGGAATGTTGTATGTAAAACAAGGGGGATGTATGGTGTTAC
ACTAATTAAATTCACACACTAATTCGAAGTTGCTGCTAGTTTCCTGCAATCTGATTGGCTCAATCATTCTTTGTTGATTCTTTCGTCGGTAGTGTTGCGC
TTTTCAGTCAAATTTGCCTATTTTGGGGGATTGACGAAATGCATTCTCCACGTCGATCCAGTTTGAATAGAACATGATATCTTTATATATATATATATAA
ATATAAACAATCAATGCATGTATTCTCATGTATAAGATATATATATATATATATATATATACGTAGTGGTGGCGTTGGAAGCCGAGAACGCCACGTCATC
GGACGTGCTATCCTGGTTGAACACACTGCCGTCCACTGTGGGTACGTGAGTCATTCGATTCGATGGCAAGTTTTGATTGGCTAAATTGTTTATTGTTATT
AACAGGGTCGCATGTATTTGTAAGTGCCCACGGGCCATTCGGAGAAGCGCACGCGGTCCGCGCCGTGGCGGTTGGCTCCACCATCTACGCCAGCGTGGGC
GGGTCATCCAACTGGGTGATCGTCAACGACTTCGACTGGTCCCCCAAGGCGCCGCTCTTTAGCGCCGACATTTCCGCCAACCGCCGCGCGCTGCAAGTGC
TCAAAAAGTTGCCGGAAGGGTTCCAGATCCAGCATCACGGCGCCGTCCACGATGTGGTAGGCGGCATACGTCGTTATGATCAGGTTTTGATTGTATGGGT
AGATTGTACGATCGCCCAAGGAACACGAGCTGTCCGTGTACATGAAGCCCAAGCCTAAAGTGGATCTGAGTCGATTCGTGCTGTGCCCGATGCCTGGTGA
GTTTAGACATTGGTGAATGTTTACGTAATCTTCGTAATATGTAGGTCTGTTGGTGTCGGTGGCTGTGCAAGCTGGCGACCATGTGCAAATTGGCCAAGAA
GTGGCTGTGGTTGAAGCCATGAAGATGCAAAATGTCATTCGCGCGTCTAAAAAAGGTATGTTGTTAGTTACTTGGTATAGTTGTTAGTTACTTTTGTTAA
TCATTTGGTGAGTAGGTATAATCAAGGCCGTGCTGCACCCTGCTGGCGCTGCGCTTAAAGTCGACGAAATCATCGTCGAATTCGAGTAGATACAGCAA