Description :
From Genome Similarity Track
Location :
Scaffold_17:642544- 643639
Transcript NameFunction/comments
Phyin_T30-4PITG_09907Arabinogalactan endo-1%2C4-beta-galactosidase%2C putative

Sequence
1095 bases(100 bases per row)
GTGTACTGGACACCTCTGTTGCGGCACTCATCAATGGCCACGACTTGTCTTCGACTGTTCTAATGGAGACGATTCATGGAGCCCAATGGATCAACACCGA
CGGCAACACAACCACCATCGAAAGTATTTTCACAGAAGGGGGCATGGACGCTGTCCGACTTCGGTACGTTTCGTTTAATACCCAGCCATTCTGACCCTAT
ATAATAGCCGTCCTGACCCTATCGGCTCTGTTTGTACAGTATCTGGACGGATGGCGAGTACGATCTCAACTATACGCTGGCTCTGGCTCATCGATTCTCT
AAGGCAGGATTTAAGATCTACCTCGACATGCATTTCTCCGATACGTGGGCGGATCCGCATCATCAAAACATCCCTGCAGCGTGGGACAATTCGTCGGTTG
CCACGTTGGCCGCCGACCTGCAAGCGTACGTGACGTCAACATTACAGGCCTTCACAGACGGCGGCATCGATCTCGATATCCTATCGCTTGGTAACGAAAT
CACCATCGGCTTCCTGTGGCCAACGGGGAAGCTAACTACCGGTAACTCCAACGACTTCGCGACTCTATGGAAGGCAGCACGCCAAGGTGTGACGGATGCT
GTCGCCACTGGAACCAAGAAACCAGAGATCATGATCCACGTGGACAACGGATGGAACTACACGTACGTGTCGGACTTCTTTACGGGACTTTTCGCCAACG
GCACCGTGACGCCCGACGACGTGGATGTGTTCGGCTTCTCGTTCTACCCATTCTACGGCGTGGAGGCAACTATCCAAGCACTTGACTCGTCGCTAACGCA
ACTTGCAAAGGACTATAACAAGCCACTCTATGTGGCGGAGACGAACTGGCCTGTGGCGTGTGAGAATGTCACGCTGAGCGCCGACTACCCGGTCAGTGCA
GAGGGGAAACGCAGTGGGTGACAGCTATTAAGGACGTGCTGGAAGGTCTGCCAAATGGCTTGGGTGCGGGTATTTTCTACTGGGAACCTGCGTACTTGTC
GGTTGCAAGTCTGGTCAATCGGCCCTTCTTTTCGATGTCAATTGGAGCAACTGGCCTACGACCTACGCTACGGCGTTTTCGTCCGTCAATATGTT