Description :
From Genome Similarity Track
Location :
Scaffold_243:64253- 68889
Sequence
4636 bases(100 bases per row)
GCAGCGATTACTATCACCCGCCAGTAAACTAAATATCGGCTCTTTTAATGTTGTAATACTCTTGCGGAGTACACTGCACTTAGTTGAGGCGTACATATGC
ATGCCACATGACACTTATATGTGTATTTGCTTTTCTATTCAGGAAAATGCCTGTGAGAGTCCACTGACACCGAAAATTGTCTGAAAATGACTGTTATTCG
TCATACATTGACGTTGGTTGCCTTGAGGCTAGTCTGTCTGCATTGATGCTATTGGCGTCATTCTTGTCGTCATTGTAAGTGACTTTTGCTGACGACGTTC
TACAATGTAAATCATTGACAAACCGTGATGTACTAAAGTTGTTGTTGGCCCTTATGACAAGTTCTCTCTATTTTACCACCGGGAATGCAATAACAATAAT
GCTAATATAGGCATTTCTGCTAAAAGAGACATTCACTCTTTTTAGGTTTGTCGACGTATGTTTAATCACAGTGCTCTCTCAACTTGAGCTGTGTAGCTTA
TTGCCTGCTGGTAATCTCCATTACAGCAAATAAGATTAAAATTAGGATTAGGGAATGAGCCATAAGTTTTTGCTTATGAGCCTTCACCCAATACATTAAA
CAAGTAATTCCGTTTATATAAGCCTCTAATCCTCAAATTGTATTGTTGTACGTTATGCTCCTAATTTTTAATTATTCCAGTCGAGAATGAGCCAGTCATA
TCCGCAGCTCCACATAGATCAAACCTTCAGCAAAATCCTCCCTAGCAAGATCCGAAGCGGTAAGGTATTTATTATCCTGGGTATGCTGCTGGCACATCCT
GCGGCTGCGCCAGCAGTAGGATAGCGGGGTATTATGGCTGCTGATGTCTTTGTGATCGTGATCGCATCGGCTACCGCAAACAAAGTCGGTGGGGTGCACC
AGAGGCTGCAAAGAACGAATTATCGCTGATGGTGTCTCCTTAGGAAGCTCTTACGGCTGGATGGCGTCCCCACGACTCGCGCTCGATTTTGCGACCGCAC
ACGCTTTAATTGGGAAGCGCAAGAGGCTGGAAGGGACTATTTATCGATGATGAAGGACTTCTTCTTCTTCGCGCGTTGCTTTGGCGTCGTGTTTATCCGA
TTGATCGGCCACGCTAGCGGTCGTCACTACAGCTATGTGCTGACATAACAAAGACTACCCGCATATATGCTGCATAGGGCAGCGAAGTACTGATAGCACT
TGAAATATAATCCAGCACCAGCTTGGTTGCGCTGGGTACGATACCGCCTCACACCGCATCTCTATTTCTTAAGAGGACCACCCCCGACAAGCTCCGACGA
CGGCACTTCGTTTCTGTTACGAACATACTTAGACCATATTCGACATTAACGTGTTTATATACAATCTTAGAAAACACAACGCACTTTTTGTATGCTGCTC
ACCCTCAAGTTTTGCTCTACTGCTATAACGAACCCATCTTCATGAACCGTCTGTTGTGGTCAGCCTTAAAAGGCTGTCAGTGAGCCATTGGAACTAGATT
TGATGTGTAATTGAAGGAAGTTTATTTACGAAGGGATGGCATCGAAGTAAAAATAACATATATATTGTCGACGACTATCTACATCTACATGAACAGTGAA
ATGGTTTGAAGCAGCATTGACATCGTTAAGTACTGACTCGTACGGCTTAATATCCTCGATCCATCGCAATGCTGGAGGTGCTGTAGGCGCTGCTTGTATT
TGCGCTACTTGAAGACATATCATTGTATTTTGCCCTGGTTTACACAGATTCCACATTGTCAAAGTCGCGTAATATTCAATCCGTTTTTTCGTGCTCAAGT
GAGATAAATTGCGGTGAGTAGAGCCTGTTGGGCGGCTATGCATCCTTACCATCACAGAATAACTGATTGAGACATCTAGAGAAACGATAGCATGATCGTA
AGCATCCGTTGCTGATGTCTGTCAGCATTTAAATACCTCTCCCGAAGTATTTGTTTAACACAGCATCGTAATCGACAGAAGCATATATGAATGCTTCGGT
GTTAATCCTTCGTGTTGAAGGTTAGACCAGCCACCAATTTTGGTCAAAATCTTGTGCTGTAAGCGGCCGTTGCAACCTGATAATTGTATGAAGACAAGGG
TGGTCCACGTTATTCGGCATGAGATATTACAAAGGTCCTGATTTAAATCTATAAGACAATGACTATAGGATGCCAGTACATCGCGACAGAAAGTTACCCA
CTACTCTCGCAAACAAAGATTCTTACAGCATCTCGACGATGGCGCACTCCCTTGCATTTTCATGGCTGATAAATATCAAGTTGACCGTAGCAAGCCAAGC
CAAGAGCTGTTTGTATTGACCATAGATTGCCTGAGGACAATAACAATGATTACGGTGCCAAAGTACCACGATCATTAATGCCAACTTAATGCTGCTTACC
TGTAGATCCATTCAACCACTTCTCGACATCCGCGTGCGCGCTCTCTACACGAAGTTTTCACATTACCGTGAAGAAGAACACCAAGAATGTAGCAATATAC
TAACATTTCCTTGAAACCAGCCAATTTTTCTTCATATACCGCATTACATGAGCTGGTTAATAAACCCTCATCAAATCATCTGCCGGTCATACTCTGTCGT
GTTTTGAGCTTATATTACAGTTACTCGCGCTGTAACTATTTGCATCTTGGTGGTGATCTTCTTGTTTACATGGCATCTAAAAGTAGTGTCCTTGCAAAAG
GAAACAGCTGCGTAGAGCGTCCATTTATGCCATCCCGCGTTCAACAACATATGTTTTCGGTGTAGTTATGCTAAGCATTTCAATCACCCACCTCAGGTTC
TACTTCGCCCAGGGGTATTCTTTCTTTCCTCTTTGACCATATATTAATACGATAAAGTGTAGCTGTTGGTGGTCACAGTAACGCCAGCAATGTGCAACAG
CGGTAGTCTAAATAGATTGGTCTTGTAAGTGGGGTAAATTAAAAATAACCGACTTGCGCAGGCGGTATTTTTCCTGACAGAGGGAGACACAATAAATAGC
TAGGTGAGATGTTGCTCAACATCAAATTTTGCGAAGTACGGTGCATTTTGTATTTTTCGTTGTTTGCTGCTAGAATCTCAAGCAAGTTTGCAAGCGGAGG
CCACCCCTAGCAATCTGTGGTGTTCATTTGCACAAATGTTATATATGTCGCGCTCAACGACACCTGCAAATCGTCGGGGGGAGGCAGCGATGCGACCAGC
GCTGATACCTGCAAGCAGAGTCGCAATCATCGATTGTTCTTGTTCTTCCGTAAGCGCCCGTCCAAATGGATGCACCTGTTTGTATGCAAAAAAATTATGG
TTATTCTATTCATGGGTGACTAAAAACTACCACCGTTCTGGTTGTTCTTGTTGGTTTAGGGTGATGCGGCATTTGCATATGCGCATGTGCTGGTAGTTCT
ATGTACGGAAGTATTATGAAAGTAGTGTACGGCATATTTAAGTGCGATGTAGATGAGTTGGCTACTATCAGCTGGGAAGGTTTGGCAGAGCTCACCCAAA
GGCCATCGGTTTCGATACCCGGTAGCGTGCAACCTTCAGGTCCTATTGTTAAAGGTTCACCAGCACTGTCCTTCCAGGCAGTGACGCCCCGCATTTATGA
CTGTAGTCCACATTCGAAGAAATGTTGTCCACATCAGAGAGAAAGAGAGCACGGCAACGACCGATAAATGTTAAATTGGAATAAATGGTCAGCGAGCGAA
GTATATGATTTTTCAGAAGGCGTAAAAAAGCAAACACGGTAGGAACGAGATAAAACACATAATTCAACTCACTTCTGGTTTTGCTGCTTCGAACTCAAGT
ATCATCCGCCCACAACCATCACACAAACACTAAAAGTTCTTGACGTCACTGTCATGTGATCGCAGCTGAGAAGAAGAAGCCAGTGGCGCGGCTAGAACCG
ATTTGCTTACAAAGATGCGCTAGACCTGAATCTGCTTGCGACCGTTGCATGAGCATTGAAGATTGACTGCTGTAACCTCACCATCCCTGCGGTTAACGAA
CCTTTGTTTCGTTCTATTTTTGTAGTATAGCCTTTCGGCAGTTTCAGCTTGTCAAGCGCGTGACGGGCTCCGTCCACAAATTAAAAAAATTTCTTTTGTG
AGCTAGCTAAGGCCTTCAATGTTTCTTCTCACGAAGGATGTCCGGGGTACGATATAGTAGGTGGCATGAAATGAAGGACGTTATTGCTAAAGTGCGTAAG
AATAAAATTTGACAATTTAGAGACTTTCAAGTCCAATTACTGGTTTAATGTATGAGGTGAAGGCTCATTAGCGGGTCGTTTGAAAATTTGAAGTAGGGTA
AGTATATTAGCATTACCTGTACTACGACCCACCATCGACCGGTACGTTTAACCTTTCTCTAACGTTTATGCATCAGAAACATAGTAGTCAAATGTTGGGT
TAAAGCAGCACTGCGATCATGAAACTGAAGGAAGATATAACCATAATATTGTTCTATTCAATCATCGAAACATGCAATATACTATGCTTGCACTAACTGC
GATGCAGTGGTATGCTGTCGTGTATCACAAACAAGAAAGTTAAGGTAGTGTCACTAAAGCGTGCTACAATTAGAAAGGTCGAGTGCTGGCTATCGGCAAC
AGGGCTACCGACGTTGCTATGATTCATCAGGAGAGT