Description :
From Genome Similarity Track
Location :
Scaffold_249:6425- 8706
Transcript NameFunction/comments
Hyaar_Emoy2813171U32 family peptidase

Sequence
2281 bases(100 bases per row)
AATATATTACCACAATGGCGGCGAGTCGTTTGCTGAAGATTTAGACCAGCATATGGTATTTCTACCTGAAGTTGGTACGCCCACGCAAGAAATAGCGATT
GATGATATCCAAGTGGGAGATCCAGGCGTCCCAAGGACTGATGATCAAGATAAGGTACGGCAAGCGATTTGGAGGAGCCGCCATTCGCTGATTGGAAAAG
GCAATGCCCTACCACCTGCGGCGCTTGGGGCAGTTTGTGATATAGATATGGGTGGGGCCAACACGGTCGCAGAGAGGGTCAGGCCTGTGGCTCCCAAAAT
TCGAGAGAAACTCGCCGATCTGATCAAAGGATTACTGTCGGCCAAGATCATCCTACCCTCTACATCTCCATGAGCGTCTCCTATAGTGGTTATCATCAAG
AAAAATGGAGAATACGTAAGGCTGTGTATTGATTACAGGAGGGTGAACCAGCTGAATAGGTTGATGGTATATCCTATGCCTCTGATCAGTGAGCTATTGC
AGGACATGGATAAATCCATGTGGTACTGTTCCCCGGACATGGCGAGTGGTTTTTGGGTGGTGGAAATGACTGAAAGGGTAAGAGCGATTTCCGCCTTTAT
CACACCATCAGGGTTGTTTGAGTGGATACGGATGCCATTCGGATTCAAACTCTCTCCACAGAATTACCAACGGTTGATCGACAACGCTCTGTACGAGTAT
CTGAAAATTGGCGCAAGATCCGAATCGATCACGGCCGGATCACTGGAGTTGATCGATGTCTTCACCGACGGTGAACCAGATACTGATCCGAAACCATCGG
TGTTGGGTCGAAGATCCTATATTGTCGACATATTGATACCAGCTACGTCGTGGAAATCCCCGTGTGAAAAAAGTGGAGAGATTATTGGAGGCGTGCGATA
AGTATAATTTGTCGATCAGTTTGGCCAAACGTTTCTGGGGACATCGCAAGGTGAAATACCTAGCACATTAAATCTCGCTCGCAGGTTTGGAAGCTAATCC
GAAAGATTTGGGATAGTTGGTGAACATCCCGTTCCCTCGGACGCTGCGATCGATGCAGTCATTTTTGGGAATTCTTAACTACTACAGTCGATTTATTGAA
GAATTTGCAATTTACGCATCAGTGTTGTACGAGCTGCGGGAAGCAGATTTTCATGAAATCAACCGCGTTAATAAAGCCAAAACCTATGTCTGCGTTAGAA
CCTGACGAAATTCGCGAAGGGCGTGAAGGAAAAAAAGCGATCTGTGCCCAAAACCGGAGATCGATGTCGATCGTACCCAATTGCAGGGTACGATCGCGAT
TCCGAGGGCAGGGGATCGTTGGGAGAAATCAATGATCCCATTCACATTGCTATAGGCGAAGTCAGCCACAGCACAGATATTGAAGCATTTCGATCCCGAT
CGACCGCCGGTGATCGTCGTGTATGCTAGTAAGTGGGCTGTATCAGCAGCTTTGATTCAAGAATATGATGGTGTTCATTGGCCTGTCACCTTCTCTAGTT
GTTCTCTAAAGCCTAACGAGGTCAATTACGGGATGGTGGAGAAAGAGGTGTTAGCTCTCCTCCAGATGCTATATATCTGCTATACTGTGCTAGTATCCCG
CGAGATTACATTGCTTACACGAGTTTTGCCACTGGCATGGCTGTTGAAATCTTCAGGTCTCAACGGAAGATTGGGAAGATGGGCTGCTTTACTATCGAAG
TGGAGGTTGGAGATTTGGCGATGTGAGAAAGGAGAAGATAAAATACTTGGTACACTTGCTGCGAGCATAACGCCTCGTGAAGAAGTAGATGAAGTATTGA
TTGCGATCGCCCCGCAGATCAGCCAAGACAGACGATAAGCATGCCACCAGTCACGGTAGGAGTGAATGAAAACCTGCTAGTAGCCAGTTTCGATGGATCG
GTTACGGTGAAAAGAAAGGGCGGGGCATGCAGCGCGATTATATGGAAATTGCCGAAGTGGACGATTGTAGCGGCTGCTTGCTGAGACATAGAACGATGGA
GAAACTCCGATCGTGGTCAGCCCATGAATTCCTACATATGAAGCGGGAGTCGAATCAGAGTGCATATCGGCTGGCGAGTGAAGCTCTAAAGCAAGAAAAA
GGAACAGTGGTGGTTTCGGATCAGGTTTGTCAAGGTCTGATCACTATCAATCGGTTAGGATAATTACTATTACCGGAGCGAATCGACTATGGAGTCAAAT
TGGCGGCTATCACGAAATCAGCTCTATGAAGACGATGTCAGCTCAGGATTTTACAGGAAGAAGTTGAGCAGCGGATACAGA