Description :
From Genome Similarity Track
Location :
Scaffold_217:6423- 7777
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_217-snap-gene-0.10Importin alpha

Sequence
1354 bases(100 bases per row)
GTTTTACTGAAAGTTGAAGGCGGGTTGATCGCTGTCGACGCCAAACGCAAACTGGCCCGACTGCATATCGAACGTTGGCTCCACATTAAAGTCGTCTTCT
TCGTCTTCGCCACCATAATACTCGCGGACAATCCGCAGCGCCTTCTCGTAGATATCTGCATCCACACCACTATATCAGCCTCCCTGCAAGTCTCAAGACA
CTCAACAAGCCTCATACCTTCATTGGCGTGGTACTGCAGCTCTTGGATCTTGTCGACGCCGCCGGCCTCCTCGATGTACATGGCCATTTTATTGTCTTCG
TGGATGCCGGCGTCGGCGTCACCAGTGTGGAGAATCTTGAGCAACGCGTCCAAGCTCAAGTTGATCACGGCCGAGTCGGGACACCCGAGCAGATTCACAA
ACGGCGGGATGCAGCCCTGCTGCACAATGTACTTAATCTGCTCAATCGTGCCGCCCGACATGGCGTTCGAGACGGCCCACGCGGCTTCCTTCTGGACGTC
AAACTCACTGGTCACGAGCTGGTGGACAAGCGGTGGGATCACGTTGGCGTCAATGACGTCCTGGATTTGCGACTGCGTGCCGGCCGTGATGTTGGACAGC
GTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGGAATCCAGTGCCATTTGG
GTCTGCAGTTCATTGCCCGTGACGATGTTCCCAATTGTACGAAGCGCCGGGGTCTGGATCGAGACCAGCGAGTGGCCCAGCAAGTTGACGAGCTGCGTCA
CGACACCGGCCTCGATCACGGCCTGGATCTTTTCATTCGAGCCATCCGACAAGTACGACAGCGCCCAGCACGCGTCGGTCACGACCTCTTCGTCCGGGGA
AAGGATCAGATACTGGAGTAGCTCCAGTGCTGGGCTCACGAGACTAAACTCTGGCTGCGGCTTGCCACGACACAGATTCGACAGCGTCCACGTAGCGTTC
CGCTGCACGCTGATCTTGCCCACGCTGCGACGCAGCACGGCCAGCAGTGGGATCATCGCGCCCGAGTTCAATACAAAGTCTCGGCAAAACGGCGAGTCGC
CCGAGATGTTGCCGAGCGCCCAGACGGCCTGCTCGCACACGTCGTCGTTGGTCGAGAACAGCAGCTCGCAAAAGACAGGCACGGCGCCCGAGTTGATCAC
GACTTCCGTGTGCTGCGTCGTGCCCGACGCGATATTCGTGAGCGCCCACGCGGCCTCAAACTGGATCTCAGGCTTGTCGTGGCGCCGGAGAAAGTTGACC
AGCAGCGGCACGACACCGAGGTTCACAACGTCCTGGATCGGCGGTTCATGCTCT