Description :
From Genome Similarity Track
Location :
Scaffold_519:6422- 9608
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_519-fgenesh-gene-0.3Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.21Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.22Glycoside hydrolase

Sequence
3186 bases(100 bases per row)
CGGCTCGTGGCCGGCTCCACCTCCGCCGCTCTGGACGCGTGGCTGCAGCGCTGCTGGGTCGCGCCGTCCACCACCGTCGCGAGCAGCAGCGACCGTTGGC
TCGTGGGTCACCGCCGACGCGTGCTCGGGGTGATCGAGGAGCAGATCGTCGCGGTCGGCGCTCCGAGTGACAGTCTCAAGGCCGACGCCATCCCGACCGT
GTGCTACAAGGTGCTGCAGTTCGGTCCACTGCCGCTGGTGGACCACCTCGCGCTCGTGCGGTTCGTGCCGGCGGGCGAGACATCGACACTGGTTGTCTGG
ACCGTCAAGGTGGTGCCGTCACCCGCGGGTGGCGTGCTGTGCTGCGGTGGCTCCATCGTGCGACTCGCACTCCGCCCCGTGCTGACCAACTACCTGTCGG
CAATGCCCGCATCATCCGACAAGATCGAGTGATCATCCACAAGCAGTGAACAGACAAAGATGGTGATGAAGACTCAGGTTCATTAGCAGTTCGTTTGGGC
CATGTAACAGCGAATAGATAGATGGCAATACCCCTTTCCAATGCCAAATGCCCGGCATGGCCTTCCAACTACCTGTCCATAATGGCCGAGTGTCGTATCA
TAAGCAATGATGACACAGAGACAGAGATGATACTGTTGATAATGTTGATGCAGCTTTCATTAGTTCTTCTTCTTGTTCGATTTAGAGTACGCAGCGAATA
GATAAAGCAGCTCCGCGGTCGTCCATACTCCGCTTCAGTGCCAAATGGCGGGCACGGCCTTCTCGATCACGGCCGTCGCGAGGCGCCGCACGGCCTCGTC
CGAGTGCAGCTCGAGCGCGCGCAGCCGGTTGAGCCCGTCGTGCTTGAGCAGCGAGTTGCACAGCACCGTGACGCGGTTCAGGTCGCGATGGTCCACCGAC
AGCGCCAGCGCCAGCACGTCGTGCACCGTCTGCAGCGCCTGCCGCGCCTCGCCGCCGCCGGCGCCGCGAGCCAGCGCCTTGAACTCTTCCTCGCACTCCG
CCGGGTGCGCCGCCAGCTCGATCAGCTTGTCCTCGCACACGGAGAGCGCTCGTCCAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTTGTTCGCGCGCTTGGCGCCTTCAATCTCCTCCTCGAGCCGGCGCAGCGCCACGCGTCGGCGCAGCATGTCGGCGCGCGCCACATTGGCGGCCTTGAG
CGCGTCGCTTTCGCTCTTGCGACGCAGCGTGAGCCTTCGCACGGGACCAGTACTGCCTCCGGTCGACTTGGGCTGAGGCGGAGGCAGCACGAGCCCCAGC
GCCGAGAGCCGGCGGCCGTCGTCGTCGCTTGAGCCGGCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATGTCCACGGACCGCAGGCGGC
GCACGTGGTGGCGGCGCGGCACCGCATGGGTCACATGGTGCGTCTGAGTCACGCGATGCTGTTGGGGGAGCGGGTACAGAGCCGCGTACTGCAGCTCGAG
CCGCTTCTCGTACTCGGGGGCCACCACGAAGTACGAGAGCAGCGCGACGGCCACGACGAGCACGCCGAGCACCACGAGCGCGAGCTGCGCCTCCGAGAAG
CACGCGACCGCCAGCACCTCCATCTTCGTCTTCAACGGGGGAAACGGGTAATGCGACTCTTATGAGGCGGTGGCTGCTTGGCAAAGGTCGAGGAGTTACG
CGTTTACGGGTTACGCGTTACGCGGCAGGGCGAGTCGCTTTTGGTGAGGCGAGCGGTCCGCGCGACGCGGCGTTCCTCCGGCCTTCGCCTCCCGTTCCCC
GACTGGTCGGAAGCACCGCTGCGTTAAAGCCGACGGTGGCGGGGGGATTGAAGAGATGCGGGCCACACCCTGGCGACGGCGCCGAGGATGCGATTGTGCC
GTTGTGAGTGATGCGGCGGCGTGCAGAAATGATGGCTCCCCCTTGAGGTTCAGCTTGAAGAATGCAGTCCAAAGGCGGAGAACGCTCTGCACTTATCGAA
CAACAACAGCAGCAACAACTAGGCGGGTTCGAGACCAGTCGCATGAGGCCACGTGAAAGATGCGGCGCGGCACGATCGCAAGCGAACAAACGACGCGTGG
CCATTACATGCAAATGCGACGCTGGGCCGCTGCTGGCCTGTATAATTAGCCTCGTCCTTCCTTCTCATCACCACCAACACAATCGCATTTGAGGATATGA
CGCATCAGTAAATTCTACTCGACCATCACGATGAACACGGCAGTGATCGCATCAGTGACGGCCTTGTCGTCACCTCGAACAGACCACTCGACCGACAGAT
CGAACTCGCCTGGCTCAACCTGTCGCTGCAGTCCGCCAGGTACAACGTAGCTCCAGTCGGTCGGTCCGAGCGTGAAGGCGACGGTCTTGCGCTCGCCCGC
GGCCAGCGACACCCGCGCGAACCTCTTGAGCAGCTTGGTCTCGGGCACCGCCGCCGAGCGGAACCGCTGCGAGACGTACAGCAGCACGACCTCCTCGCCT
TGTAATGCGCCGGTGTTCTCCACCGACACCTGCACGTCCAGCGTCCCCGTCGCGGCCGCCACTGTGGCGCTGCTGAGCTTCAGCTCCGAGTACTTGAACG
TCGTGTAGCTCAGACCAAAGCCAAACGGCCACTCGACAGGACAATCGATCCACGGCGCGCACTTGACGTTGACGCGGTGGAAGTACGGCAGGCTCAGCGC
GTCCAGCTTGGGGTACGTGAGCGGCAGCTTGCCCGACGGAGTAATCGCCCCCACGACCACGTCCGCGATCGCCTGACCGCCTTGTTCGCACGGTAGCATG
CTCAACAGCACAGCATCAGCTCGAGCATGCGCTCCCTTCAGTAGTCTCGGTCGCCCCTCGACCAGGACGAGCACGACCTTGGTAGACAACGCCGTGAGCT
GCTCGAGGTACTGCCGCTGGCCGACAGGGAGAGCGAGATCGTCGATGTCTCCGCTCTTCTCGGCGTAGTTGGGCTCGCCGAGCACGACGATAGTGTAGTC
GCTCGCGTTCGCCATCGCCAGACCAGTCTTGAGGTCGTCAGGTGTCGCCTCACCGTCCATGTTCACGACGTCAAGGTGGTCGACGATGGTGCGAGACCCA
ACGCTGCCGCGAAGCGCGTCGACGATCGTCGAGCCGTGTGGGAAGTGCGACGAGTTGGATGATCCCTGCCAGAAGATCGACCAGCC