Description :
From Genome Similarity Track
Location :
Scaffold_559:6422- 8093
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_559-snap-gene-0.137 transmebrane protein Gpr8

Sequence
1671 bases(100 bases per row)
GCTCTAGAGCTCCTCGGTGGGCAGGTGTTGCTCACGCAGTGACGCCTTCTCCGACGGTGACGATACCGAGTACAGACGCTGCAGTGAAGACAGAGAAACA
ACACCAGCCCGTTCGTGAACAAAGACAGCAGCCGTTGGGCTACAAAGGAAGCGTGGATGCGCACCTCAAAGTAGCGTGGCGCGCGCGACGGCCAGAGCAA
GTAGACGAGCGCAGCGTAGATGCAGAGCTCCACGCTCGTCGTGATCGCCGCAACGGTCTTCTCGCGCACCCACGGTGACAAAAATGACGCGATGAGGACG
ATCACCGGCAGCGCGGTAATGTACACGGAGAAGAGCCCGGCAATCTACAGACATACAGTCAACGAAGTCAAAACGTGGGTAAGCCATTGACCACCGGTAT
TGCTACTGTAACAACCCGTACCTGGAGGAAAAAGCGTCGCTTGCCTGCTGCCTCTTCGTACGCGCGTGTGTCCAGAATGGTGTTGACGAACCAGACAAGC
ACGCCCAGCAGCATGACGCAGATGCCGATCCCGGGCCACGAGTCGTAGATGTAAAGCGTCGACGCCGGGTCGAGCCAGACGAGGTACCACATCGCCATGG
ACAGGTAGAGCACGAGGATGGAGATGATGAGACACGAGAGCTTCTCCTGGCCCTCCAGGGCCACGCTGTTGATCGTCCAGCCCTTCGCGACGAGCATCGC
GAGCAAGATCGTGCCGACGCGCACAAAGACCTGCATGATTTTGGCCGAGTACTCGAAGAGCGGCACGCCCACGCCCGTGAACTGGTACACATAGAAGTGG
AAGAAAAGTAGCGCATTCGAGACGCTGAAGAAGAACAGGACCATCATGAGCAGCTTCATGATCGGGTGGAACGACTCGGACTGCCTCAGGCCGCGCGCCG
CGACCGTCTGCACCAGCGCCGCTGCCGCTGAGAGCACCGCCATGAGGCCGTAGATGACCGTCATCCCCTGCTGCTGAACGGGCAGCTCGCTGCCGTTCGC
CTGTGTCATGTGGATGCTGTACCACGACGAGAAGTAGTACTTTCTGAAGTTCGCCTCGGTGATCTGCGTGAACGACGGCTCGTATGAGTCCCCGCCCGGC
ACGCATCGCGCGAGCGCGACATACCTGCAGCACAGTACATATCATGCGTTAGCATTGTTTTCAAACCAAACAAAAAATGATTGGCTGTGAGTGCATACCA
GAAGCGTGGACGCAGGTGCTCGTGGATGTCAAAGCTGAACGTGAACGGGAGCGACAGGTCCGTGGTCGCCGAGACGTTGTACAGGCCCTTGGTGTGCTCT
GGCGAGATCTTGCACAGGCAGTCGCAGTCTTCGTCGGTCATGATGTACTCCCAGAAGAGCTCCTCGTCGTCGTAGATGGCGAGCTGCAGGTCCTGCACGT
CGGTCTGGATCTCGCCCGTGATACGCTGCACAAGTTCAAGATACAAGCAACGGGTTAGTATCCACAGCTACGTGACCACACCGCCATCACCAACAGCAGC
AGCACGCACCCCAGCGAGCTCTTCGAGTGTCGGCTTCCACGTGAAGCAGAACTTGCCAATGAACTCGAACTGGCGGCCGACCGCGAAGCCTGAGTAGACG
CTCGCGCGCACGCACGACGGCGCCACCACGAGCGCGACGAACAACACTAGAAATAGCAGCGGTGATCGTCT