Description :
From Genome Similarity Track
Location :
Scaffold_434:6422- 16806
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_434-abinit-gene-0.14DnaJ homolog subfamily C member 13

Sequence
10384 bases(100 bases per row)
CATTTCTTCTGTTGCCGCGACTTGTTGCGGCTGTACGTGGCTGCCGCGCGCCTCCCGCGCCGCGAGATGGTGACCGACATGAGCGACGCGTTCGTCTGCG
TCGATGGCGGCTCCTTCCACGGATCCAACACGGAGTATCGGCGCTCCGACTGCATCCCAGAGTACGCCGTCATGTCCGAGAAGCGAGCGTAACCGCGTGA
TGTGCCATACGTCGAAGGCGTCGGTGTCGCGTACGTCGACGGCATTCCGAACGTCGATGGCATTCCGAACGTCGACGGCTGCAAGGAGTCATTGGTGATG
CTGCTGATGGGGATACCATTCCGTCCCAGCATTGGCGCCGGTGGAATAGAATCTCCCGAAGCTGTCGGCAGATCAGGCAGGCTCCCACGGCGCGACACTT
CCCCACGGAGCACATCGATATCGACCTCGTCCTCATCGTACTCTTCCGCCTTCTGCGAGTGATACTGGCTGTCAGTGAGCTCGTAGTGGGACCGCATAGC
CATTGGCTTGGGCGACAGGATGGCCGAGTCATTTGGCAGATTCCCGCTGTATCGGAAACTCCCCGGCACGTCCACATCGAGCAGTTCGACGTCTTGACCA
TTGTAGTTGATGCTCTTCGGAGGCGCCGCCATAGAAAACGACTCGTCATTCATCTCCAAGATCGTACCGCCCATTCCTGCTGCTTTTCGCTCGCTGTCGA
CATTGAATGTGCCATTGTAAATCGATACATCTCGTTCCTGATCAACATCGAAGCTGCGATTGCTCAACATCGCACCAACGTCCGATTGTGTCGGCACTGG
AGGCTTTGGGGCGTCACTCGCAGTCTTGGCTGAGCCGCGGAAGAGAGACGAACGAGTATCCGAAATGGTGAAGTTGTGCCATCGCCCGATGAAGCTCCGC
GTCACACTCGATTTGAACTGTTCTTCTTTCGGGAGCTCGGCGTGGATAATCCGCAACACTCGATTCACATTCGACAGCAGTGCCCCATCGATCTGATCTT
TGCCGGCGACCAAGCTCTCCAGAAACGTCACCATCGGGCCGTAGTACTTCAAGTCACGCAGCACAAAGTCCGCATCGGTGGACTTTCCGTCCGACAATAG
CGCGGCATTTCTCGCTTCAAGAATGCGCCGAACGAGCTTCACCAGCGACGGAATATCTGCGTGCTGAAGTGTCATTCTGCAGAACAGCAGCTCGAGGAAC
TCTCCAGACGCCAAATCAGGAAATTGGATGAGTCGGCGCGCGATTCTCAAGATGCATCGATACGGGAAGCTCGTGATCAGGTGCTTGTTGCAGTGCCGAA
CCAACTTCACGATCTGCTCTGGGATGCCGCTGTTCGCAATGCGATCGTCAATGTCAAGGGGAGCCCGCAAGATGATGACTACAGCAGCTGTCAGCTTTTC
CACACGATCCGCTGACACCTTGAGCGTGTCCGGAGGATTGTGTAGGTCGAAGCCCATCAGATCGTCCATCTCGACCTCCCACAGTTGGAAGAGCAGTTCT
AGATTATACGCAGGGTTCGTCAGCTTCTCGGGATCGGGTCGTGACAGGAACCGGTCCAAGTACAGGCCAGCAATGAAGTTGTTCGGGTATTCGACACAGT
CGCTATCTTCAAGTAGCACCGAATCGCGTTTCGCCACGGAACGCTCCAAACGATTCCGACAAATGACTTCATCCAGCTTCTTCCGAACTTCAGTACGCTT
CATCGAGTTCCAAATGAGATCGCTCTTCTCGTGGTTGTCATCAAAGAATCGGGAAGCCTTGCTAGGGTCGAGGTGGATCTGATATACGACCGGGTACGGC
AAAAAGCGCAGCAGACCGGAGTACATCCGATCTCGGATGCCCACATCCTTGTCCAGCAAAGCGTAGATGACTTCAAATGCTGGTTCACGTAGCGCCTCGG
CGCGAAGAAAATGCTCATGGAGCACCTGTTGCTTGGATTGGAGTGCCAGCCCAAGGACTTCGACCCACAGACCACTCACTTCAACGTACTCTGCGATCGT
CAGGCAGGTGTCGCACAACTCGGCGAGGCATGACAGCGCGTAGAATGCCTGTTCATAGCTCAAATGATCTGTGATCACCTGGAGACTCCAAGTAAACTGA
CAGAACGGTGCCAGCATGTTCTCCAAATTGCATGGAAAGCCGCAGATCTTGTTGATCACGAGCAACGCCAGCTCTTGACGCTTCAAGTAATCCTCGTTCC
CAAACTCCGCCTCCATACTGGACTGCTGACCATTCGGATCGTTCTTCCCCTTCTTCGACTTGAACCCGTACGTCGACAGTGACCGACGCGACGAAATCGA
CACCGCCTTGGACTGGTCGTCGCCATCATAGGGCAACAAATATCTTCCGAGCGTCGACACCGAGATCGCAGCATTGGTCGCGTCAGGGTCATCCACGTGC
GTTTCAAGACATTCGACGAACGCTCCTCGAAACACTGGGACATCCGCCAACAGACTCAAACACTCCAAGGCGGGGAGCGTGTCCGAGTAGATGCCGAGTT
TGGGGTTCCTGTTCTCGTTCAGAAACATGAACAGCGACTCGATAAAGCTAGAAGGGCTGGCTGGGAAGAGCATGTCGACGGTAACTGACAACGGGTCCGC
AATACCCTTTTCCAACAGGACCGTCAAGTAGATCCCACCCACGCGCGGCTCCGACTGAAGGCAGTCGTACATGTAGCTCGTCGCGCTCTCCAGTACTGAC
AGCTCGTCGCCATTCCCATTCATGCAGTATTCTTCCGTCAACGTCGATAACTCGCTCCGTGTATCAGCATTCCAGATGCAGGTCGGCTCGCGAATATCCG
ACAAGATGATGGTACAGAATTCATGACCGTTAGGCTTGTCCAGGCAGTCGAGAAAGTCGAGCGGCAGCATATTCGCAAGCGCATCTAAGCCCTTAGATCG
ACTAGTCCCATCCGTTCCAATCGCCAGCGCGCGCAACGCTCGAAAGGCGCTTTCAAGCATCTCATACTCTTGCTTTTGCAGATTCGTCTCGATACTCTCG
CCAGCTTCGATGCTAGCTGCCGACGCCAAGATCAGGTACAGACCCTTCCAGAAGATGCGCGTGGTGGTCAAGATCTGGTCACGCACGTCCAAATTGCGGC
ATATCTCCGAGACAATGTCGAACGACAGCTTCTGAATGTGCCACGGCTGGATGTTCTCGAACGACAGGATCACGTCATCAAGCAGGGTGAATATTCGCTC
AGCGTACTTGGCGACAGACACCTCTCCGCTTTGTGATTCGTACTCAGTCGCCGTGAAAAACGCAGCAATCTCATCGTCGTCATCGTGGATGCGACTGGCA
AGACCTACAGACATCGGTGCCACTGAATTGACATGCCCTTTGGCAGCAACAAGAGACTTCATGCCTCCCTCGGAGGCAAGGATGAGCTGCAAGATGGAAA
ACATCAGCTCTTTCGCCTCAATGTCCCGACGAAAAGCGAACGTCTCGACCGTCTCGAGAATTGCATCCCAGCTTCCGTCAATCTCGAGAAGCTTGGAGCT
GTTGTGAGGAGCTGCCACCAGCATTCGTTGGAGCACTTTCATCGCGAGTCGATTGAACACGCTCTTTTTAGTCGACTCACTCTGGTCAGTTTCAACACTC
TCGCGATCCATCAGCGTTTTGAGGAGCAGGTCCAGCGTCTTGGAGTAGTACGAGGCAAACTGAATGGTGAACAGGTCCAGCAACTTCAGTTGCGCCTTGA
GAATGCACTCGATCACATCATCTGAGGTCTTCCCCGCATCCACTTCATCCTTCCGCTCGTACAGCGTGCAAAGCGTGTCAAATGCTGCTCGAACGGTCTG
GATACTCGTGCCTTTCTTGCACAGCTCGCGGTATCGTTCTCGCAGCTCTTGCATCGAATAGGACGGATGTCCGTCCCATCCGAAGATCGAAAACGCCTCC
GTTGCATTCAGTTCGTTGACAGTATCACTGTGCTGCCGTCGAACCAGGAAACGCCACTTGTCCTCGATGCTGCTCATCAAAATCACAGGCTCTTCAATCG
CTTCGACGTCGGCATCGGACTGAACAAACGTCGAGAGGTAGTAGCCGCTGCAGTAGACATCGCCAGATAGTTCCATGTACGTCACCGGCGGGAGTGGCAC
GTAACTATACGTCGCTGCCACGTTTTGCAGCAGCTCATTCGTGAACTCTCGAAGGTGTTCAGCGACCATGTCCTGCAAATGCCGGCGCATGGACGGCGAC
CACAAAATGCGCTTGTCGCGCTTGCGTCCCATGAAAATGTCGGCGAATACCTCCGGCGACTCAGAGTCCAGCAAGCCGATCAGAGACTCCGGAAGAATAT
CAACCAAGCAGCTTTGCCCGTAGCGCTTCTCTTCCACTCGCTGCATCCGGTGTAGCTTGGCTAGCAGCTTCGCCTCCAACACAAACGAGTCTGGCGCGCT
TGAGTGCAGTTCAGTGGCGAAGATAAAGTAGAACGCCCCGGTCACAAACAGGTTCTCCACCAAAGTGTCGCTTAGACTCGACAGCATTTCGCACACGTGA
GATCGAACGTCGCGATCATTCACGAGTAGCAACTGTGTCAGCAACGGCAAGCTTGCTGAGTTGGAGATGACTACTGTCGCCAACGGCAGCGGCCACAGCT
CGCGTCCTGGCGAGCGCGAGATCCTGGAGCTGCACAAAAAGTTGCGCAGAATCTTCAAGGCGTACGTTGCACAATCCGGGTCAACAGATTCGTCCGTCAA
CTCCATCCATCGCAGCTCCGGCACTGTGTAAACAGATTTCCACACGTGCACCTCGTCAGTGTCGCCGTCATGCATGGCGCAACAGCATACACTAGTCTTC
AGCAGATCAGCCTGCTGCATCACAGGATCGGTGTCGAGGAATTGTTTCAGGGCAACAGCTGTGAACGGTCCCGCAACTGCATCCTCCCCCGTCGCAGCGC
CAGAAGTCACAATTTTAACTCGCCATGTCAAGCTGAATCTGGAAGTGTTGTCGTAGAACGACTGGCCTGCGATTGGAACAGACGATGTTCTTCCAAGCTC
TGAGGTTGGCTGCAGCTCGACCACCGGCACATCGTCGTCATCGCTGCCGATGTTGCCATTTGGATGCATTCCAGCCCTCCGTCGACGGTGCGCCAACAGC
GACAGATACAAAAACAGCTCGAGGTTGCCTTTCGAACAAAAGAAGTCCATCAACTCAACGGAGCTCGTCAATTCTCCAAGCAACTCCAGCACGTCCTGAA
TATCGCTTGCCACATAAGCCGATCGAAGGAACGACATCAAAAACCTCGCGCGATGCTTCGTGATGGTACACACTCCCGGAAAGGCGCGAGCCAACGCAAT
CAGCAACTTGAGCATCCAGTATCCGTTCTGGTCGTATTTGTCCACATTGGCAATATCGTCGATAGTATTCGATCGGCTGGATGAGTAACCGACTTGCGAC
CCACTTCTCGACTGGCTCAAGTACAGGTTCTCCAGCCAGCACTGGTACACTTCGTTGAAAAAGTGAGAAGGGTTCTTGGCAATGTCTACGCACGCGTAGA
ACGACTCGCTGTGTCCCTTGATTTTGCCGCGATAACCGCTTTGAGTACCGTTGTCACGAAGAACACGAGCGATCTCCAGAAGTCGAACAGAGCCGTCGTC
AATACGTTCCCACAGCACACGGATATAAAACCCTCCCACTTCAAGTTCTCCAGCGAGAGAGCTATACGATACTCGGAATTGTTCGTGATTCCACAGCAGC
TCTTTGGCTCGGCCCTGAGACGCAATCAGAGAAAGAGCTGACAGCTGGTTGCTCTTGAATTCGTCAAACCCATCGATCGCTTTCTCCAGAGTGCGCCGCA
GTTCGGCTCGACACTTGTCGTTCCAAATCAAGTCCGGTAAATAGTACTCTCGATGGACCATCCGCGCCAGCAACAGCACATCCAATGCAGACTCGCCTGG
ATAGTTTATCCGACCGTTGTCCACCTTGACTCGAGGGGTCTTCGTTTTGGTGTCTGAGAACAATGCACCAATCTCCTTTTGAACGCGCTTCACGAATGCT
TCGGAAGTGTCGAAGCGAGCGCCAGCCTGACCATGTTTGCTTTTCCCGGACATTTCATTCTTTGTGCTGCGCTCACGTTCCTTGCGGATCAGCTTTCGGG
TGCTGGAATGTGAGAGCATCCGAATAAACCCATGCGGCAACGTTCGAACCAGCAAGTCAAACGATGGCTTGTGATGAACCATCCAAACTCCAGCGATGTA
CTGATACGCTTCCCGTGCAGATCTGAGCGGATGGAACAGCGCTTTGTAGAAACACCTCAGCGTCAAGCCTGTCTCTAGCGCCATATCGCATATCCGTTGC
CGAGCTTTGTTGTCACTGTGATCGACAACGATTTTGAGCATGCAAATTGCGAACGCCGCAACACCGCCGTTCACGTTCTGACTTGCGAGACTGAGCAGTT
CAGTGTGTTTGGAACTGAATGCCTTGACAATGGCCTCGAACTGGTTGTTGTCGGTATTTTGCCGAGAGCTGATCAACACATCCATGAATAATTCCAGAAC
CGCGATTGTCGACACCGGATTGCGCTGATCCAAGATCCCCACGAGAAGGTGGATGAGCTTCTTGCTCTCAAATACTTGAAACCGAACTCGCTTCTCGCTT
GGCTGCTGGCTGCTGGAGCGCGACTTGCTCGAAATAAGCGAGTGGAGCGCGTTGACTGCCCAGACTGTTGCGACCGAGTCGCCAGACACCAGCACTTGCG
AAAGCAACGACACCAGACTCGTAATGTTCGCCTCGCTTTGCTCCAAAGTCATTCGGTAGCAGCCGTCGTTGATCCGACAAAATGAAGCCAAGACAACAGC
AATCTCATCCGTTCGGATAGGTGGCTTGCATGCGTTCTCCAGCTACACATAATACAGCGGCAAGATACACCGTGAGTTAGTCCAGAAACAGAACAAATGG
GGTAGATAAACTCAAGCGAACGTACCAGATTAATCATCCCGCGCAAGAGTGTGGCAAACGATAGCTGCTCAATCCGGGTTTGAATGGCTTTGCCAGTGAA
ATCTTCCGTCTCCACGTTCATGTTCATACTCTCGAGCGCAAATATCACTTTCTCCGTGGCTGACGAGATATTAGCTCCTTCCTTGCCCATCCTCTCGATC
TCCTTAGTAAGCACAGAGTGTGCGGGGATGTACAAACCCTCTTCGTTCAGCAAGAACACACGCTCCTGGTCGTTCATGAGGAGCGCTCGAGCAGTCATCC
GAGGATTCACTCGAGAAAAGTCGCGGCTCAACGACACCATCCAATTCTTCGCTTGGTGGTAGCTGTCATAAAGCGAGCCAACAAACACGTCCACATCGTA
CGGAGCGTACACAATCCTCGCGCCGTCGCGGAACTCGAGGACTACCACCGCTTCAGTGTCGTTGTTCTCGACCTTTGGCACGGTGACACGGCGAAGATCC
TTCAAAGAGTACGATTTCTCCTCGCCGTCGGCGATTTCTTGAATAGACCCATCGACAAACATGAGCTTCTTCTTGCGGTAGTGAGTGAACCCGTGGCGGC
CAGTACGACGCTGCACATTCATCAAACCCGCTGGCCCCTCGTCATTACTTCGCGACGGCGCTATGAAAGATGGCTTCGGCATCCTGTCGCTAACTGTCGG
CAACAAGTTGATTCCGATGACTCCCGCGAGGTCTGTCATCTTGTCCAGGATGTCGTTGCTCTGGTCCGAGTACACGTATCGGACCTTGCCTTTGACCGTA
ATGGCGAATGTGTTTGGCACAACCTTGGCAATGCTGATCTTCTCGATAGCGCGAAACTCGAATTCGTTCGTGTTGCGGTTGATCACTCTGACCGCAATCA
GCGCACGTGGAGTCAGAAAGATATCCGACTTCTCGCGCTGTCCGTCCGACGACCCAAGAAAGCCACTGAACTGGTGGCACTCCACACAATACACTCGCTT
GAAGTCCTCGAAATTGCCCACCATGTGGCTCATCAGCTCTTGAAGAAAGACATTCCGGCAGCGGAAGCGGAGTCGAAGAAACACCGAGTCTTCATACTGA
TCAAGACTCGTCTTGAGCGCACCGCAACTCGACTCGACGAAGACGCGATACTGCTTCAGGAGAACCTCCGGATTCTGTACGGCAACGACACCTGCATTCG
TGTTGCTTCCGATGGACGACAGCGAGCTGGAACTGTTGTATCGACTGGGCGGGTACCGACTCGATGGTGGACCTCCATATCGTGATGGAGGAGCCGCTCG
CGCAACAGCAGCGCCGTAGTTCATGGTCTCACCAAAGCTGAGAGTTTGTCTGGGGATCTGTCCATCCCGAGAGCGCACTGGCGAGCTCATATTGCCAAAG
TGCAAGAAAGACGGGTTCTTCGTCATCCGAGCGAGAATAGCCACAGTGGCTTCCACCGTCGCGAGGGCCGGAAAGCCAAACAGGATGCGCAACAGCATCC
GGTATTTGGTAGCTAAATGCTGATACAGCGTATCCGAGAGTTGGCGCTGCTTGTCGATGTTGACCTTCACCAAGGCTAGCACAAATTGGCACAATGTCAT
GGTCGGTAGATCCGTCAGGAACGTTTGTGCCTGATGTAGCATTGGACACGACAACTCCGATCAATGAGAAACATACCAAATCAACGATGCACATGACAAG
TTGCACACACCTGGGGATCCTCGTCGAACATGGACAGAACTGTCACAACAAAGAGGTTGTTCGACAGCACAATGTGACGGAACGCCGATCGGTGGGACTT
GGACTCGATCAAGCGAATCAAAACCTTGAACATCCAGTACGTCGACACGGAACGATGGCTCGTTAAGATCTTGGTGAGCGTGTCGATGTACTCCTCTCCT
CGCTAAGAACGAACACAGAACGTCAGACAGCCTGCAGGTCACGAAGCAAACAGACTCGGGAACAGTACCTCTGTCAGGATCCGAATGAATTCGTCCTTTG
CTTGCGGAACCAACAGTACCCGGTACAGAGTTTGCAGATAGGTGCAGATGAAATCATGTCCTGCTCCGTGGCGATTGACGATATCGTGGATCTCTCGAGC
GACCACAAACACAACTTTCTCGTACGGCTTGTTGGGCTGAGCAATCACACCTTGGGTTGAGGTATTCACGTTCAGCTCCGCCGCGAGTGAATGCATCTCT
TCGTCGAGTCCGCGCGGAAGTTGTCGCTGAACACGCGCCGTCTTGCTGTAGCCGTGAACGGCGAGCAGCTGGAGAACGGACGACTGCGCAACTCGAAGCT
CCCGATCTATCACATTCACGTCTCCAACTTTGCTGAACATCTTGGCGCCTTCAGTTTGGATAATCTTACGCGGAACCATTTGCACCCAGTCTGGAACCAA
CACTGTCTCTACATCCACTTGGCGATTCCCCAATGCGTGGCACGATGCCAACAGCTCGCAAATAATCTTCTCCCGTTGAGCGGCGTAATACTTGCTGCGA
ATGCCGTCCACGAAGACAATCTCAAACGCTTGCTGTGTGTCTTGAATGAGAATCAGGCTGTAAATGCGTGTCAACGGCCGACTGGAGACCAGCTTTCGAG
ACGCGGTGTACTCGATAATGTACTTCTCCGTAATGGCGAGCACTCGCGGCGTGGCGCTGGATTCGTTAGACTGCGACACCTTGAGCACCCCGTACTGGCA
AGATATGTCATCAGCCAGCGATGCGTTTGGGTCCTCCTTGAGCGCGCTGTCCAGCGTCTTCTTTCTATACTCGTTGATGGGCATCGCGTATGCAGTCATG
ACGCGCCGAACAGCCTCTGCGAGTTCGGTTCGACGCTTTGGCACGACAAACAGACTGGAGTTGTCCGAGTGGTTCAGCAAGATAGCGTCGTGGTCGTCGC
AGATCACGTCGATCGAGACCAGGCTCGTGTACGGGATGTGCGACATCAGCTCGCCTTCCTTGTCCTTCTGGTAAATGCCGTCCGGTCGAACCTCGACGAC
ACATCTGGCCTTCAATCCGCGCTTGTGGTACTTGATGCAGTCGAACGAGTACGTCTGCAGCTCTGCGGGCACTGGCTGACCTCTTGGCAACTTCGCTGCG
TGTTGGCTGCGTAATCGCATGAGGCAGACCATCACTTCCATGCGATAGTGGCATCGATACACTGTCCGCTTGATCTTGTGTCGTGGCGTGTGGATCACAA
AGTCCTGGCGATGAAGAGATCACATCCCACATCAAGGCACTCGTCAGTACAGCTAAGAACAGCTTGCCAGTCCCAACATCACTCGCTCCTCCGTACCGTC
TCGCCATCTAGTACGTTTGCGCCGTCGACATCCTCGTACGGCCACGTGTTGGTGAGCTGCTCTGTGTCGCGGTCGAACGTCGAGAAGCCGTACTCGCCGA
AGCACAGCACGCGCTCCTTAACGACGAAGCTGCCCACCTTGTGCACCATGAAGCGCGCCACCACGCGCTTCATCTCCATCTTGG