Description :
From Genome Similarity Track
Location :
contig_5:642109- 644318
Transcript NameFunction/comments
g1764.t1OWZ08005.1 hypothetical protein PHMEG_00019519 [Phytophthora megakarya

Sequence
2209 bases(100 bases per row)
GTGAGAATGGAGCAAATGTTTGACAAAGAGCGAGCTCTCGCTAGTGAACGTATTATGCAGCTCACCAATCGCCACGAGCGTGCGCTAGCTGCCGAAATGG
ACGAGCTAGATGTAAGATAAACCCGGGATAATAGTCGGAGCTTCTGAAAGTGGTGGATTAAAAAGCTGGGCCATCACTTGTTGATCCCAACAAGACGATA
CCGAAGCTCTTCGACTACGTTTCTCAAGCCAACAAGCTGCTGGTTGCTTCGCTCGCTGAATGGATGAGTCATCTTGTGCTGTGACGAGATCGTGAAGGAG
ACATCTCTCGACATGGACGAGTGTCTTGGCGTTTTTGAGAACATCATCGAGACGAGTAGTCCTGCTGCCGCTTAACCGACGGACACCTACATGAACGACA
CGCTTAAATGTGGTCTTGCCTTGCGCAGTCATTATCACTCAGCTGTCCATATATTCAGTAAGAAAATCACCTGCAACGATGTATTTTCATCGACATTTTC
TGTGAATCCTGTTGTGTTAAAGATTGAGTCGAGTGGCTTCAGAGTGTTGGTCAAGTTCAACATCACCCCACATCACTTTTCTTCACGTCGTACGCAACCA
AAATGGTAGTAACTAAGCGTAAATATGGTCAAATGGATGCTGATAGCCCCCAGTTCCCTCGCAACACGAAGCAGAGGACAAGGCAGGTGTCGAATCTAGC
AACTCTCGTGAAACAGGCCACTAACGACGGCGTGGCGTTGAGTTCGCGGCTGAATTTGGCGCTCAAGATGAGAAAAGAGATAAAGCTGCTGGATACGAAT
CAAGTCGTGGACTTCTTGAAAATTCAGCAGCACCTGGTGGTAAAATTGGCAGATGCACTGCTACACACGGCCTACGTCCCGCTTCAGCAGTTGTTCTACA
TGTCAATAGCGAGCTTGCTGAGTACGCTGAACGGAAGAAACGATGTACTAGCTGCTGCTGCCCTCCACCGATTTCGTGAAAGTGTGAAGCAAATTGACGA
CGTTCTGCTTAGTTCGCTGCCGGTGGACGAAGTGGTCGAAGTGATCGATTCGGTCTGAGTAAAGGTTGTTGAGATTGCAACAAGGGGAATGCGATCCTAA
GCTATTTCCGTTGCGTGTGCAGGACAACACGATCAAGGTGCGGAAGCAGGTGAATGCACTGAATAGGAGCTCGAGGATATGCCGAACGTATATTGTACGG
AAATGCTGGATCTCTTCCAGTGGGAAGGGCAAGTTGGTACGCGAAGTTCCTTTTTCGCAGTGATGATGCGATTATACAAGCCTTATGCGTTCTGTGGTGA
TAGGTGCCTATTGCAGTTGATAAGTGGCTTGATTTTGGGGGAACAATGGTGACATTTTACCATCAGTTGCCTCGAGAAACTATCCTGTACAATATGCCGT
ACATATGCGTGGAGAGGCTCGAGTTAGATGAAACAAGATGCTTGGCGTATATTTTCACGAAGAGCGTGGTTGGATTGGATGGAATCAACGTGGTGGCCTT
CATACTGGAGTCTGCGGTAAGTCTGCAGACTTTAACTGTACACATCACTACGGCTAACATTGGATTCTGTGTCTTAATAGGATTTCCCTGCATTCGTGGA
TACCTTATGCGCGGTCAGGCCTGAGATCACTACAATTCAAACTGCTCCACATCCAGTACCGGTAGGGTCCAATTCAGGTTTTGCAGCTACTTGTGAGCTA
CGTTGTATAGCCTCCAAGCTCCATCCGATACATCACAAGACACCGTCACCTACAGCAAAACCGAACAAACGACCCCCACCTCAAAATCTCGCTGAAAGCA
GAGCGATCTCGATAAAAGCAGAGATGGCTCCAGTTGCAAGCGCAGATTTACCCTCGAATTTACCCACAACAGAGCTTCAGCTCGCTCCTTGTATAACGAC
AACAACGTCTCCTGTAGGGAGGATTTTCGACGCAATAGTGCCGCTGCACATGGAAGCTGTCGGTGCAAAACGCGGTGCAAGACGTTCACAGATATCGGCT
ATCCCAACTATTCAGCGAGTTCGGGAGGAAACTGTGAGGGCAGCATTAAGAAACCCATACATCTCAATGGCAGACACTCGAAGCTCAAGTTGCCAAACCC
TTACTCCCGCATATACCGAAAGAAACACTCGACCAATTCGTGATTGTGAGATGGTTGCAGCGTCAGTGGAGACCCTTTATCGGTGTACTAACATCACTGA
ATCGGTTGT