Description :
From Genome Similarity Track
Location :
Scaffold_80:6421- 17057
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_80-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_80-fgenesh-gene-0.3Polymorphic outer membrane protein

Sequence
10636 bases(100 bases per row)
TTCTGTGAGAGCTGACCGATATCTTGGAGTAATGCTTTGACCTTCAAGTCAGTTGGGTTCGCCTCCTTTGTGTTTGATAGAGCAGCGCTCTGGAAGGCTT
CGCCTCGGTCGACGGAAATCAACCGACCGGAACCGATCAAGAGCGTTAGCTTCGTCTTGGCGGACGCGTGTGAGCAGAACACGAGTACGTCCTAATGTCC
ATACAATAGAAAGGTGAACAACCCATACCATAGTAGAGGTGCCGAAGACAGCAGACTCACCTGAGACTGACTCAGCTCGGCTGAATAAGCCACGAGTGGT
TTCGGCGCGCTCATACTTGCACGTGTGTTCTCGTGGAGCTGCGTGAGAAGTTGCGCCATTGGAAGAATGGAGATCTTGCGGCCAGCCGTGGAGAACGCGA
TCTTGGACTCGTCGTCGTCATCCAGGAAATGCACACTGGTAACAGGAGTGCCAAGCGTTCCGACGCGGATTTGTGCGTCTGTGAGTCCGTGTGAGAGCAG
CACGACTGACCCACGGGAGCCGACCACGAGCAGCGCATCGGCGCCAGTACCCTTCTCCACGCGAACAGGCACCAGCGAGTGGATGGGCTCAGACATCTGC
GCGATTTCTGTCACGCAATCGACAGCTCTTCGGGGACCTGCATCCACGACAGCACACCGAACTTTGCCGTCCGCGTCCCCTTGTAGGATCAGTATCCTCG
CCGGGGAGCCGGGCATCTCGCCGAGCAGCCACGACGCGAGTCTTCTGTGACTGCCAGCCGTGACAACACACAGACTCGTCGAACACTCGCCGTCGAGGTC
GTCGATTTCCAACTCCCACTGTGCAGAAGAAGTCTGGAGAAGGCCTCCGACAATGGTTGTTGGGACAAGTAGACTCGTACACACGAGGAGATCGAGACCC
GCGAGGTAGACGAGTTGCTGGACTCCGGGCACNNNNNNNNNNGATCGACAGCTCTTCGGTCACCTGCATCTACGACAGCACACCGAACTTTGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCAGGCGCACCAGCCACACACTTCCACTGCTCGTCGCGACGGCAACTTGAGCTGTTGATGACGTGGCTGCCGTTGCCNNNNNN
NNNNCTCGGCGATGCGGCGCACAGCGGCGTGGCTACTACACAATGATCACCATCAGTCCATTCAGTCCCACCGAGACTTGTGTTACTCACGGTTTTGATG
CCATACCTATTGGGAGAGGCGTCTGCGGGAGCCTTCAGCACTAGCGGCTTGACGCCCATGGGTGTTGTGGNNNNNNNNNNGTCGGCGATGCGGCGCACAG
CGGTGTGACTGCTAAACAATGATACACCATCGATCCATTCAGTTCCACTGAGACTTGTGTTACTCACGGTTTCGATGTCATACCTATTGGGAGAGGCATC
TGCGGGGGCCTTCAGGACTAGCGGGTTGACGCCCATGGGTGTTGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATCGCACTGCGCGACCCCAA
CGATTTCTTCCTGGGAGGCGATCACGCACTGAAAGAAAGAAACAGTCGTCAGCTTTACTAAGCGGAGTGGAGGACATGCGCATCGTACCANNNNNNNNNN
AAAAAACAGTCGTCAGCATCACCAAGCGGAGCGGAGGACATGCGCATCGTACCATGAGTACGCCGTCTTGGACGTAATGCAGCAGCGTCGGGCGAATCTG
CACGAGCGTACGCAGGGCANNNNNNNNNNCCATCTTGGTCTCCCCAAAATCTAAACCTCCAAAAGTAGTACTCACTTGTCTATCTCATNNNNNNNNNNTC
ATCTTGGTCTTGCCGCCAAAATCCAAACCTCCAAAAGTAGTACTACTCCGGATTTAGAAGAGGTAATACTCGTTTCGGTTTTAGCGAGGACGTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTACTCCGGATTTAGAAGAGTTCATACTTGTTTCGGTTTTAGCGAGGACGTATAT
ATGTATAGTTCGCGAGTATACCTTCGACCCTCATTCCTGATCCCCTCGTTTCTGAGTGTTGGTCCCTCTGTTGGTGCCGAAACCCACATTCGACGTAGCT
GCTCGCCGCCCGCCAAGAGCTGGTCGCCATGGACCGCCTCTTACTCGAGGATCTCGCGCACCTCTTCGAGTTCCTCACGGCGTGTGACGTCGCGCAGCTC
ACGCGCACGTGTCGCGCGTTGCAGCCGCGCGAACCGACCGTGCAGGCGGCGCTCGGGCTCGTCCTCAAGCACCGCTTTGGCGACGTGGTCGGCTTCTTGC
GCGAGGACGACACGCACTGGCCGCGGTCGCCGCTCGTGCTGCGCTGCGCCGAAGTGCTGCGTGTCCGCGCTGTGCTAAACACGGCTGTCCACTCGCCCGA
AGACGCCGCGACGCCCGTGGTGAACCGCTCGGCCGTGCTTGTGAGCAAGGCGTGGACGCTCGCGTGGAAAAAGCGCTGCCAGCCGTACGAGCAGTACCTC
CAGCAGTTTCGCCTCACCAAGAAGAAGCAGCTCCAGCGCGAGCGGTCGCTCGACAAGCGCAAGAATAATGCGAAGGGTGCTGCTCCCCACGAGGACGCGT
CTCGTCGCTTTGTGGACGGCGACGCGGCCGCGACCAAAGAGACGAGCGCACTGATCGTGTGCCCCCACGACAAGCTGCTGCCGCTTGCGTTTTGCGTATC
GCGTGCCAAACGAGCCGTCGTGACGCGCAGCGGGTTCCGCCTGCTGGCGCTGTACGCGCCCGACGTGCGCGGCTTTGCTGTGTACACGACACCCGACTGC
CTGGACTGCGTGCAGGAAAAAGCCGAGTCCGACCGCGACGACGACCGCCGCCGGCAAGAGCGGTTCGAGGAATCCGTGGCCGGCTCCACGGCGCTAGTCG
ACGTGCTGCTGCGCAAGAACGGGTACCCGAACGAACTGTTTTCTCCGGCCACGTCGCGTGGCAACACGATGCTGTCGCTGCACCACCAGAGCCGCCACAC
GTTCTACCTCGTGCCCAAGAAGTGGCTCATCAAGTGGCGAAAGTATGCGCGCAGCCTCGCGGACGACCTGCCCGGCCCCATCTTGAACGCCGAGCTGGTC
TGCGACACGCACCAGCGCTCCATCGTGCCGGCGTACATCACCATGTTTCTCTCGGGCTTTTCACTCGAGGTGTCGCTCCAGGCGACGCAGGCGTGGGTTT
CTCTTCTCTATGGGCTCTGCGTTTTGATGTTGAAGTGATCTCACCGTGTTCTATTGTTGTGGCTGACTTCATAGACTTGGTGCGAGTGCGGCGACGCAGT
ACGAGATCGTCACGGACAGTGAGTGGGAGGCGCTCTTTGATCGGTACTGCGCCGAGTACGCCGTGGGCTTTGACGTCCACACGGGATCCTACCACTGGCG
GACGCCCGAGTGCCACATCTGTCACTACGGCATGGGCGGCGGCAGTCGCCGGGAGCGACGTAATCCGTCCCGACGCTGAACAAAGGCACACCTCCGACGG
AAACACAGGAAACTAGTTTGCACAAAATGCATGGAATGGACAAACCCTATTTCCACCTACTCTTCCTTGTTCGCCTCGCTCTCTACTTCCGCAAGCTCGG
GCAGCCGCGTTTCACTACGCAGCGACGCGAGTCGTTCGCGCTGGCGGACGAGCTCGTATGGGTCTGAGGTGAGCGTGTCCAGGCGCAGGCGGCGGAACGC
CTCGAGCACGGCCGGCACGCTGAACTTGTCAAACCGCAGCTGGCCATACTTGTCCATTTGGCCCTCGTAGCACGCGTAATTGAACGCGCGTCGCCAGCGG
TGGAGGACTTCGAGTTGGATGCGCCGCTTGCGGGCGGCCTTGTCGGCGACAAAGAGGCGGCGCGACTCGTTGATGCCGTCGCGGAAGATCATGCCGACGC
CAAAGATCGTCACGGCGACACACGTGCCAACGAGCAAGACGCTGAGCAGCTGCTGGTTGATCATCGACTCCTGGTTGAGACTGTTGAGCTGGATCATGAC
GCCGAGCCAGAGCGTAAGAAAGAGCTGGAGCTGCGTGACGCTCGCTATGAGATTGTCAGAAAAGTCGCCGTACGGCTGGAAGTAGAGCAGAAACCACATT
GTGACGAGGCACACGGTGATGGCCAGCAGCACTTGCTCGACGCTGCCGTTCTTGACAAAGACAATGACGCCGCTGAGGAAAAGCTTGCGTGAGAGATCGA
TGACCTCGAACCACCAATACTGCTGCGAGTCTACAGACAGACGAGAAAAGACACAGATTAGCTATAAGCACGGGTCTCGATCGCTCACAGAGTTGCAACA
CCCACAGTCGGCATAGATGAAACCCAGCCGAGCCTCCACCGTCGAGTCGGTGAGGTTCTTGTAGCGCATGTACTTGGCGAGCTCCTCGTTCTGGACGTCG
AGACTGTCCATCTCGGCAACGACGAGTCCGCGCTCTTCGTGGAACGCACGCATTTCATTGAGCCACTTGACGCGGAGCGCACGGCACTGCGGTTTTTGCA
AGAGCTTGACACGCGCGCGCACGCCGCGGTCCTGCGCAAGTCGAATCAGCAGCCAAAAGAAGAACGGGATGCCGACAACCCACACACCCACGCCAATCAT
CGCGAGCACGCCAAAGACGGCCCATGACGAATCGTAGCATATCAAGCGGCGGTCCACGACCATGTAAAAGACCGAGCCAATCTCCTGGCAGTTGAAGATC
GTCAAAATGGTCTTGGACACGGTCGGGTACAGAAAGAGCGCGAGCCAGCAGTAGAGCTTGAGGCACTTGTTGCGGTACGTGAGGTAGTTCATGCGCAGCT
TGACACGCGCCTGCCACACGCGCAAATTGCTTCGGATCGTCCGCTCGATCATCGCACCCGAGAGCCGGTGGCTTGTCGGACACTGGGTATGCACCGACCG
GAAGATGCCGAGGTGCGGGGTCTTGACCTGAGACATGCCAAACTCGCGCTTGAATCGCCTCAACTCGTCGTGGGCACTCTTGACGTTGCTCGCACTTGGC
GCACGCGACAGTCGGCTACCATGGGGCTCCGTGGGGCTCAATGCAGCGGCTGCGTTTTTGCCTTGCTGCTTGGCCTGCTGCCGATCGCGCCACCAGAGCT
TGGCCATGATAAGCGGATTCAAGCTCGCTTGTTCGCTCTCAAATGTCTGGGCCTTATCACTTTCGAGAACGGGCAGCCCGCAGTGCAGGCAGTTGCGCGG
GATTAACAGCAGCTTGGCGCTGTAGCTGCGCATGCCGGCGTAGAAATAGGCCGTGACCACAGTGACCGTAATCCCCACCAAGACGATCGTGACCCTAGAA
GGATGAGAACCATGGAGCTGTGAGTACGGCCCGTACGTCGGTAGGGAGGAGGCAAGTGTGGGGCTACTCACGTAAAGTCAAAATAAAATGTCTTGGTGAT
CACGCAGTCGATGCCCGCGATCGCCACGAGATCCTACGCCGATAAAAAGAGAGAGATGAGCCCATGAGCCGAACACCCTCTGTGATCCACAACCCCCACA
CGCACCAAATTGAACTGCGCTGAAAAGTTCATGAGCCGCTGGACGTCGCCCGACCATTTCACGACAAACGCGTCACGAAAGTTGCCAAAAATCTGGAAAA
AGCCGATAAAGATCTTGAATTTGCCCGCCTTGATCGGGAACGGCCGCGACGGCGGCTCCACGTCAATGCCAAACAGCACGCCAGCCTGGTTCTTTCGGCC
GCGGCGACGCAGCACCGGCGGCAGCTTGGCGAGCACGGCTTCCTTGGCTCGCTTTAGCAGCTCTTTGAGCTTGGTTTGCACCTGCGTCTTCTTCTGTTCG
TACACGCCCTTGGCGCGCTCGATCACGCTCACGCGTCGAGACTTGTCACTCGGTGGCCGCAGCCTTCGATCAGCCTCGGCCTTTTCGAGCAACGCAATCT
CCGTGAGGTCCCGCAAATAGTACTTCACGGCGTAAATCGCCGAAGCGAGCCCCAAGATGATCAGCACTGGGATGACAAAGTTCTGCCACTGGATCGAGTG
CCGCATCTCGTCGTTCACCTTGTTGCAGGCTACAGCATCCAGAGAAACGGTTAGGAGTCCGCCCGCATATTGCATAAAATCTTTTCACGTACGCAAGCAC
GAGCCGTCCTTGGCCTTTTTGAAATTCGTCGCACACACGGAGCAGATCGCCTGGTCGTATCCGTGGCCGCAGGACTCACTCACGGCGCTTCGCGCCGTCG
CGACCTCCAAGGTGACGTCGGCCTCGCACGCGTCCTCGACGTCGCACGTGTAAAACGACTGGTTCGACAGACAGGCAAAGACGCGGTCCGCTGGCCAACT
GTCGACAAAGCGGGGCCCGAGCATTGAACACTGCTGAATAATCTCCGTGACGTTTGTGCCCTTGGGCTGCTTCTCAGCAACGGCTTTGCAGACGTCGGCG
TCTCGCCATTGCGCGGGATCGCACGAGCGAATCTGCTGAGACGCCGGTGCCGCAAAGAGGTAGTACCCCTGGATCGTCCGCGGCGACGACGTGCCGAACT
CTGAAGCCTTGGTTTCGGTCGCGCGGCGCACGTTCATGCTGCAGTCGGCGCCATTGGGGCAGTCAAAGCACTTGAGTCCGTCGAGACTGTACTTGGTCTT
GGCACAGCGCGCGCAGTTTCTACAAAGCAAAGCATTAAGAGAGATTAATTACCCACAGCATCAAACGCTAGACAATCGTGACGAACCCGCTGTTGGCTGT
CGAGTACCCAGCCGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGTAGCGTAACGTTTTGCGTGAACCGTAGCGTCCTTTTCTCTGGCAGCACG
CACGTCATATTGAGAGCGTACGGCAGCGTCTCGCGTGGTTGGCCGCCTTCAAAGGTTGCCGCCACAAACGAGACAATGCCGGCGATCGCAGCGCGTCTCC
CCCACGGCTGAAAGAGCAACTCGCCCCGGATGGCACTTGTAACCGCGCACTCGGTCACCGTGTCCAAGACTTCGATCTGGTTGTACAGATCCACGGCCTG
GAGCCGTGGCCAAATCAGTTTCGTGTCACTGAGACTCTTCTCCGTCGTGTTGATCGGAGTGAACGACTCTTCGTCGCGCGGCTCCATGGTCGCGACACCG
CTCGTGACGTTCGTAGGCCACCACATGACGGTCACATCGCGCGTGTTGGTCGCTACTTCGTACTTCGTATTGTTGGCCGTGATGCAGTCTGTGCAGGGCA
CAAAGGTCGACGTCAGCGTCGTGTTGTACGTCACCCAAAAGAGGCAGCCGCCACTCTTNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCGGCAGTCGATTT
CACGAGTAGTGACGCCCCCAATCGACGCATAGTAAAGAGCACCGCCTCGCGCAGACGCCACATTGTCCGTGAATGTGGACTTTTCGATTCGCGAGGCGAA
CGTCGCGGCGACGTGGACCGCGCCACCCAGCGCTGCCGTGTTGGCTTGAAATCCGCACCCGTTGACACGCGCTTGTCCGCTCTCAGTAACGAACACGGCA
CCGCCGCCTTGCTGGGCGGCGTTGGAGCGAAATGTCGAATTCGTTAGGTGAACTACACTGCCATCCGCGACTGAGACAGCGCCACCCACGTCGGCGGTGT
TCTGCGAAAAGTTTGCACCGCCCACCACTACGACCGAATCGTCGGATGCCTTGAGGCGAGCAGCAATAGCACCGCCCATGAGATCGGCCGAGTTGGTTGT
GAACAAAGTCTTGCCGCCGATGTACAATCGTGTGGCGCGGTCGGCGAGGATCGCGCCGCCCATGCCCGCCGTGTTGTCGGTAAACACACAGCTTGTAATA
TTGATACTTGCATCGACGCCCGTGATGGCGCCGCCGCCTTCGTTCTTGCCCGTCAGCGTCACGCCGCCGTTGCCACGGAAAAGAGAATTGGTGGATTCCA
GCACAGCGTCCCGACTGACAAAGATGCCGCTGCCTTGGCCCTTCGCCTGGTTCTTTTGCACGATCGATTCGTTGAGGACCGCGCGCACTTGGTCGCCCGT
GTCCATGTACAGTCCGCCGCCCGAGTCGTCGGCGATATTGTCCGTGAGCGTTGAATTCACAAAGTCCAAAGTGCCGCTGTTTTGTATGTACATACCGCCA
CCAAGGTTCCGGGATTCTAAGTCCACAGAGCTGTTAGCGCACCACCAGTGCCACCGTCAAAGTAAAACCCGAACGTACCGCTGTGGCCCACGACGCTGCG
CTCAAGATGCGCGTGCGCAAGATCGTTCACCATCAAACTGCCTCCCGCTTCTGTGGCAAAATTGTACTCTAAGAGTACATCCGTGATGTACAATTGCGAC
TGCGTGTCCACGAAAATGCCGCCACCACTTTCCGCGCGGCCGTAGCTCACTTGCGTCGCGCTTAAGACGAGCGTCGTCTCGCTGCTGCCAGCACTGCCGC
CGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCACCAATGTAAAAGTGGCCGCCACGCGTACTTTGAGACACGGCAAGCTTGTTGGTTGCA
GCTGCGTATGTAGTACCGAGGAGTCGGCTGAAACGTGTTGTCCACTCTGGCGTCACCGCTGTCGGGTCGTTGGTCACATTTGAGTCCTGTACCGTGAGGG
CCGACTTTTCTGACACCGCCATTGCCCCTCCAAAGGGTGCCGTGTTCTGCAAAAAGACGCTGTGAGAGATCACGCCAATAGCCTCATCGTGGACCGAGAT
GCCGCCGCCGGAGCCTCCGTCTCGCAGGTTCTTTGCTTGATTCTCAACCAGCAGCACGGACGTCGCTGTCAGATTGCCCATAGCCAAGGAGACTGCGCCG
CCGTCGTCTAGCGCCTTGTTGTGATAGAACGCACAGTCGGTCAGCATCAGCACCGGCAAGAACGCCGGTGGACTACCTCCCGTGCTGCTGACACGGTCCA
CAAAGAGCGCGCCTCCGCTCGTGGCGGCATTGCCGTCATAGCCCACGTCCGTGACACTGTGGTTCCCGTCGCCAGTGATAAACATGCCGCCGCCCCGGGT
TGCCGTGTTATCTTTTACCAGCAATGACGAGAGCGAGGCCGAGCCGCTGCCTGAGACGAATACGCCGGCGCCGTCGCCGTCCGTCAACACCGCGTTGGTC
ACAGCAAGTCCCGTCACAACGCAGCTCGCCGATTCACATTGCACAACCAAGTTGGCGCCGTCCTTGGACGTCGGAACGGAACTCCTCGAGATCGTTGAAC
GGCTGCCGACGTCGCTAGGATCCAGTGCGGTAAAAGTCATGGCGGCGTCCGCATTCGTCGCTCGCACCAAGACGCCACCGGCCGTGACGTCGGCTCCGTT
TTGGTCGATGACGAGTCGTGAGTGCAGGACGCGACTATCGTCCACCACGATGCCGCCCCCCTTTTGTCGCGCAGTGTTGGACGAGAAAGTCGACGACTCG
ATCCGGCAGGATGTGTTCTGCCCAAAGAAAGCGCCGCCGCCAATCTGGCTCGCGACTGAGTTAGAGACGACGATGTTTTGAAGCTGGCACGAGACAGTGC
CGATTGCTGCGATTCCAGCGCCTCGTTGAGCCGCGGCGCTCGAGATCGCCACGTCGCTGACCACGGCGTTTGACCCATCGAGCACAAGACCACCACCGTC
AGCGGATGCCTTGTTACTTGACACCACTGCGCGGGCAGAGCTTGCGCCACTGGCAGCCGCGAGACTGCCGCCCGAGACAAAAGCGCCTCCGCCCGTTTGG
GCGTCGCAGGCATCGATCGTCACGTCATCGTGTTGGACGGACGCGTCGACCACGTAGAGGCCGCCGCCGCGACCCTGAGGAACGGAGCAGGAGCGAATAC
GCGTGCGCTGGAGCAGCAGCGTTCCGCCCAATGCCGCCACACCACCACCAGACTCTTTGGCATTGCAACTCTCGATCGTAGCCCCCGCGAGTTGGCTCTT
GCCCTTCGTCGCAACGCCGCCACCTTGAGCCGCCGAATTGTCCCGCAAGGTAAACCCGGTGCTGTCCACAGTTGTCCCATCCAGCCACATCCCGCTGCCA
GTGTGGGCCGTATTTCTTTCCAGTGTGGTCGATGATACTATGATTGAGCTGGCGAAAGCGTAGACACCGCCACCGCTACTTCGACTCCCATCCACTGGGC
CCGACGCTTCGTTCTCGGCGACGTGCAGCGACTTGAGCGTGGCGGCTGTCGCCTTGTACGTGAAGATTCCGGCCCCGGCGGGAGCACGGCATCGCACAAT
CTCGACCGCTTCCATGGAGCTCTGTGAGCCTGTGAGGTAGGCGCCACCACCGCCAGTGTCCGAAGCGCAATCTTCAATCCGCGAGCCCGGACCAGTGAGC
GAACTCGCATCCAAGTAGACGCCACCACCGAACCCAGTGCTAACGTGGCCTTGGACCACCGAGTCTGAGAGCACGATCATGCTTTTGTCGATGGCTGCGA
AGCCTCCTCCTTGGGCCGCTTCACAGCCATCCAGCAACGCCCTAGTGAAGGTCACTGTGGATCGCTTCGCACCAACGCATCCTCCAAGGCTCGCTGCTGA
CGACCACCGAACGGTCAGTCCATTCACCGTTGCTGT