Description :
From Genome Similarity Track
Location :
contig_5:642063- 644272
Transcript NameFunction/comments
g1641.t1hypothetical protein
g1642.t1hypothetical protein

Sequence
2209 bases(100 bases per row)
AATTACTGAAGGTCTTGGAGGAAGAGCACCATGCTGAAGAGCAGCGCGAGCATCTTCTGCGCCAGGCAAGTGCTGATCGTCGGGAGCGCGTGAGAATGGA
GCAAATGTTTGACAAAGAGCGAGCTCTCGCTAGTGAACGTATTATGCAGCTCACCAATCGCCACGAGCGTGCGCTAGCTGCCGAAATGGACGAGCTAGAT
GTAAGATAAACCCGGGATAATAGTCGGAGCTTCTGAAAGTGGTGGATTAAAAAGCTGGGCCATCACTTGTTGATCCCAACAAGACGATGCCGAAGCTCTT
CGACTACGTTTCTCAAGCCAACAAGCTGCTGGTTGCTTCGCTCGCTGAATGGATGAGTCATCTTGTGCTGTGACGAGATCGTGAAGGAGACATCTCTCGA
CATGGACGAGTGTCTTGGCGTTTTTGAGAACATCATCGAGACGAGTAGTCCTGCTGCCGCTTAACCGACGGACACCTACATGAACGACACGCTTAAATGT
GGTCTTGCCTTGCGCAGTCATTATCACTCAGCTGTCCATATATTCAGTAAGAAAATCACCTGCAACGATGTATTTTCATCGACATTTTCTGTGAATCCTG
TTGTGTTAAAGATTGAGTCGAGTGGCTTCAGAGTGTTGGTCAAGTTCAACATCACCCCACATCACTTTTCTTCACGTCGTACGCAACCAAAATGGTAGTA
ACTAAGCGTAAATATGGTCAAATGGATGCTGGTAGCCCCCAGTTCCCTCGCAACACGAAGCAGAGGACAAGGCAGGTGTCGAATCTAGCAACTCTCGTGA
AACAGGCCACTAACGACGGCGTGGCGTTGAGTTCGCGGCTGAATTTGGCGCTCAAGATGAGAAAAGAGATAAAGCTGCTGGATACGAATCAAGTCGTGGA
CTTCTTGAAAATTCAGCAGCACCTGGTGGTAAAATTGGCAGATGCACTGCTACACACGGCCTACGTCCCGCTTCAGCAGTTGTTCTACATGTCAATAGCG
AGCTTGCTGAGTACGCTGAACGGAAGAAACGATGTACTAGCTGCTGCTGCCCTCCACCGATTTCGTGAAAGTGTGAAGCAAATTGACGACGTTCTGCTTA
GTTCGCTGCCGGTGGACGAAGTGGTCGAAGTGATCGATTCGGTCTGAGTAAAGGTTGTTGAGATTGCAACAAGGGGAATGCGATTCTAAGCTATTTCCGT
TGCGTGTGCAGGACAACACGATCAAGGTGCGGAAGCAGGTGAATGCACTGAATAGGAGCTCGAGGATATGCCGAACGTATATTGTACGGAAATGCTGGAT
CTCTTCCAGTGGGAAGGGCAAGTTGGTACGCGAAGTTCCTTTTTCGCAGTGATGATGCGATTATACAAGCCTTATGCGTTCTGTGGTGATAGGTGCCTAT
TGCAGTTGATAAGTGGCTTGATTTTGGGGGAACAATGGTGACATTTTACCATCAGTTGCCTCGAGAAACTATCCTGTACAATATGCCGTACATATGCGTG
GAGAGGCTCGAGTTAGATGAAACAAGATGCTTGGCGTATATTTTCACGAAGAGCGTGGTTGGATTGGATGGAATCAACGTGGTGGCCTTCATACTGGAGT
CTGCGGTAAGTCTGCAGACTTTAACTGTACACATCACTACGGCTAACATTGGATTCTGTGTCTTAATAGGATTTCCCTGCATTCGTGGATACCTTATGCG
CGGTCAGGCCTGAGATCACTACAATTCAAACTGCTCCACATCCAGTACCGGTAGGGTCCAATTCAGGTTTTGCAGCTACTTGTGAGCTACGTTGTATAGC
CTCCAAGCTCCATCCGATACATCACAAGACACCGTCACCTACAGCAAAACCGAACAAACGACCCCCACCTCAAAATCTCGCTGAAAGCAGAGCGATCTCG
ATAAAAGCAGAGATGGCTCCAGTTGCAAGCGCAGATTTACCCTCGAATTTACCCACAACAGAGCTTCAGCTCGCTCCTTGTATAACGACAACAACGTCTC
CTGTAGGGAGGATTTTCGACGCAATAGTGCCGCTGCACATGGAAGCTGTCGGTGCAAAACGCGGTGCAAGACGTTCACAGATATCGGCTATCCCAACTAT
TCAGCGAGTTCGGGAGGAAACTGTGAGGGCAGCATTAAGGAACCCATACATCTCAATGGCAGACACTCGAAGCTCAAGTTGCCAAACCCTTACTCCCGCA
TATACCGAA