Description :
From Genome Similarity Track
Location :
Scaffold_39:64201- 65630
Transcript NameFunction/comments
Sapdi_VS20SDRG_11083hypothetical protein
Sapdi_VS20SDRG_11084hypothetical protein

Sequence
1429 bases(100 bases per row)
ACTTAAACAGACAGCGCAAACGCGGTGGCGATGACGATGGTCACGGTCGGAAGCGCCACAACGGTAGCTGTCGACGGCTTGGTCGTTGGCGCCGGTGTCG
AGCTGCCGAGGTAGAGCCCCAGGTTGGTCAAGAACGACGAGAGCGACGTGCCAAGGAAGGCCGAGACGGTGACGTTGCCGACCGTACAGTTGAGGTTGGC
CTTGGCGACAGCTGTCTGGACGTCCGTGAAGAGCACATCGCAGCTGGGCGTCTTGGCGATGGCCGCGAGACTCGTTGCATTTGGTGTCGGGCCCGCGATA
GAGATCGCGACGCCGCTCTCGTTCGTGCATTTGGCATAGTTGGTGCTCGCGAGCACGGGAAGTAGCGGGAGAGCGAGGTCGGTCGCTGAGCAGGCGGCGC
CCGCAACCACTGAGAGCGTGCATGCACTGAAGAACGCGGTGCGAAGTAGGCCCACCATGGTCCTCGGTCAACTGTTGGCGCTTGGAACTGCGTCGGTTTT
AAATGGTTTCAGGAGGTGTGTGCGACCATCTCAGACCGCTTCAGGGGTCGCCGATCTATAAGTTCTTATGGCTATACTATGGTGGCTTTGTCGTAGACTT
ATTTCGTTTTGCACCAATAATTGTTTACTTGCTAAACAATTTGAGGATAATTGTGTCTACAAGACTAGATGCGCGGCAGCGAGGAGCGTCAGAGTCACAC
TTGAGAGCGCCGCGAGAGACGCCGAGTTGTTGAGAGGCTTGGAACCGGCGGGCGGTGCCGTCGTTGCACTCATGTACGCGTTGAGGTTGGTCACGAACGT
CGTGATCGAAGTGCCCACAAAATTCGAGACCGACTGCCCATTCACGGTGCACGTGACGCCGGCGCTGTTGACCGCGGCCTGCACGTCGTCGTAGAAGGCG
ACGCAGCTCTTGGTGGCGCCAATGATGGCGAGGTTAGCCGGGCTCGGGAGGTTTCCCGTCAGCGAGAGAGGCACACCGCTGTCCTTTTGGCAATTCGCAT
AGTTGGGCTTGCTGAGGACAGGTAGCAGCACGGGAACAAGAATCGTCGACGAGCACGCGTCACCAACAACGGAGCTCACGGTGTACGCAAAGGCGAGCAG
AACGAACGGAAGCAATCGACGGGCCATGGGAAAATAGACTCTGCCCATCCCAAAATTTGTGATGGAAAGAGAGCAGAAACGTCGAAAATCGAAATATGGT
GGGAGGCCGACCTGCTCTTCCTGCTTTACAGATCACTGATCCCAACGCCAGAGAATTTCAGAGCCGTACCTTGATAGAGTTGCTACCGGGTTCCAGATGC
TACCTGCGCCGGCTCACCTGTGCCCATGTCTCGCCCAGCTTGCACAATACAAAGCTGATTACCATGATGCACGATACCTTCGCTGGCCACGATGGGGGAA
TTTTCCTTCGATTTGGACGGTAGGTGCAT