Description :
From Genome Similarity Track
Location :
Scaffold_70:6420- 7494
Transcript NameFunction/comments
g6109.t1hypothetical protein

Sequence
1074 bases(100 bases per row)
TCCGGAAGGCACTTCACCACATAAGCTACAAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAAGATGGTGTACTGTATTTTC
TTGGAACGAACCGTCGGTGGGGCAATGAACGCCGAGAAGAGACAACGATGCGTCTAGTGGTACCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCA
CGACTCGTTGGAAGGCGGCCACCAAGGTATCGGTCGAACTTACCACCGAGTCAAATCAGACTATTTTTAGATCAGATTATATGCAGACGCCGAACGACAT
GTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAACGTCTTGGCAGAGCGACCGTTCCAGATGGTGT
CGATGGATTTTGTTATACCGTTACCGAAGTCTCGTCGAGGCAATTCAGCCTTATTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTAT
GTCGGACACTACCGCTCTGAAGGTCGCACAGGCTTTCGAAGAATGCGTGTACCGAAGATTCGGGGCACCCACGCTAATCCGACATGACCGAGACCCTCGC
TCCATGAGTGAGGTGTTCCAGGCCTTTGCAGAGATGATGCAGTCTCGGTCAAGAGCGACCCTGAGTTATCGGCCGCAGGCGAACGGACAGCAAGAGCGGT
CAGTGAAGACAGTCATGCAGTCGGTGCGAGTGTACGCGGAAGACCCGCTACAGCAGGACTGGGACGAGATCGCAGAGCGGCTGATTTTTGCTATCAACAG
CCCTCAAGATGGCACACGAAAGGACACTCCGTTTTACCTAGTTCGTGGGTGGGACGCTCAATCCACGCTGCGAGCGATGTCTTCGTCACTCAAACGAGGA
TTCGGAGGCCAGGCTGACGCGTTGGCATGGCGCCGAGAAGTGAATCGGCAACAGGAAATCTCGTGGAGAATGGCGATGGAGTACCAGCGTGTCGAGTAAG
CTCAGAGAGCAAGAGAGCACAATGAGTCGCTGGAGCGGCGCGAGAGAGCTGCAGTACCGAGTGTCGATGAAAAC