Description :
From Genome Similarity Track
Location :
Scaffold_1217:642- 3894
Sequence
3252 bases(100 bases per row)
TGCAGGCATACTTCGATGCGGCGATGGAAAGGTTCTTACAAGAACGCCAAGCGCCATCAACACGCCCTAACCGAGAAGAGGCTGGCGACAGGGAGCACGA
CCGGCGACTACTGGAAATGGTCCAAGGGAAGAGGTCCAAGCCCAAAGACAACCCCAAAATGTCAGACGTCGACATAGAATCGGTCGGCTCGTGCGAATGC
GGCCCGGATGATCTGGACCTGGAGGAAACTCCGGCGAGGATGGCCAATGCCACGATGGGATAGCTACTCAACATGGGTCCCTCGCATCACGCTCTCTGCA
ACTTTTGGGACCTCAAAGAGTTTAATGGTCGAGACCTAGACGAGGACCGAGCTCGCAGTTGGGTAACCACAGTGAAGACGGCCTTCGCAAGTGACCAAGC
ACCGGACAGCAAAAAGTGTCTGGTCTTCGAATGACTGGTGATTGGGCCGGGCAAAGAACTGGTACCACCAATTGAGCCGCTCCGTTCAAGAAAATTGGAA
AGACCTGCTACGAGAATTTCAGATGCAGTTTTATAGTCTGGGGGTACCAGTTGCTCGCCAGTACTACCACGCGAAGAAGAGGTCAGAAGAATCCACGTTG
GACTACCTATACCGCCTGAACGTGATTGCTCTCAGGGAGAAGCTGAAGATCAAGAATGGATCACCCAAGATCCATAAGGAACACGTCGAGCATTACATCG
AGACTGTAGACGGCCCATAGTTGGCAGACCAATTGACGATGCTACGCCTAGCAGACGTTGAAGGATTGGAGGAAGTATTGAAGGCACGCCAGAAGACGAA
GGCACGACGCGGCAAGACGCTGTTTGGTATCAGAAAGTTCCGGCAGTAAGTACCTGCACCTCCGGATCGACCTAGAGATTTAAACCGCCGTTCTATGCAT
GCAGTCCGAGCGACACTAGAAAAGTCGAGTTCGGAGGATCCAGCCTGGATTTCGGATAACGAGGGAGACCTGAGACGGATCGACTTAGCGGAAGCGGAAA
GGGACCCAAGTCCAAGAACCGCGAGGAACCGGCCCCCAAGAGAGGTCGACTAACATCGGAAACAAGCAGAAGGCCCCAGAACCTGCAATACGTCGGCCGA
GTCAAACGTACGATGCACCCAATACGGGTCCAGGAGACATGGAGACTTGAGATGCTGGAAGAGAATGACCTGTGACCACTGCGGAAAGAAGTGACATCCA
TCGGATCGCTGCTTGTTCGTGTGTCGGGGGTGCGGAGAGACTCATGAAGCGAGGAAGTGCCAGCTGAAGGACTTCTACAACTTGATTCGTCAATGGTACA
ACCCCACCAAGCACGCCGGAATGTTGCCCGAGAAAGCGGAGAAGATGATAAATTAGAACGCTCGCCAGGTTTGAATCCGTTACGAGTCGAGCGTCCTAGT
TTTTGTATCTTTGCATATGTGGAAAAGCAGCCCGAGAGGGATAGGGGGATTTTCTATTGAAAAGACCGATAATATATCGAAGATTGGAAAATATCACATG
GTCCATGTTGTTTCTCTCAATGAACCTAATGATTTCGCCCGGGAAAATGCAGTGATGGAATTAGACCTATTGCCTGGAGAATACCGAGGATACTGGAAAT
AACACGCCCCAACTAAGTGGTTTAAACAAGCCAAAGCCTCTGGAAAGATTAACAACGATCGCGCAAATTTGTTGTTCGATACTGGCGCCGAAATATCCAT
TTAAAATATCGCCTTTGCTCATAAGGTAGGCTGCCAAATTGACGAAAGCGAACGACAAGAGTGCATTGGCATTGGGGAATCGGTGTACTCTACGGAAGGG
CGCACTTGCATCAAGGTCACCCTAAATGGAAATCTAGTGTATGTGTCCAATGTGTGGCTAGGCCATATGGTAGGTCAGGATGCAATATTAGAATTGGATT
TCATGGTCCCGGCTGGTATCCGGCTAGATCTGGTGGATGGAACACTCTGTCTCCCCTAACGAATTCCGGATACAACTTTCCGGACGAAGGACCGTTTACG
GTAACCGAGTCGCAGAAGTGAAGTTGGGACAATATGCCCGTATACTTGCCCATGGATGTCTGGAGGTACCCCTTAAAAGGTCGATCTCAGATCTATGGAG
GATATGGGTCACAAGAGGAGAGTGATGGGTTAAGACTATGGCTTGGGGAATAGGACGTTGACAATTGCTGAAGGTGACCAACTTTAGCCCCCACATGTTG
AAATTTCATGATGATACCAAGATAGGTAATTGGCAGAAGAAGGATCAAGTACCAAGAGCGCAATGTTTCGTCTTGGTAGGCTCTCAAAGGTACGCTGAAT
GGCTGAACCTGGCCTACGAAGCCACGACCGACCAGGTCGACCCCCAGTTGACCTCGAGGAGAAAGACGAGACACCAATGTGGAGACTCCGTAGTACAAGA
TCCCGTCGCGTATTTTGCAGCGGTCGAAGACCCCAGTCTCAATTATGAACCTGTCACACCAGCGGCTACCAGAGTGAGAAGAACAGTCACGCGAAGAAGA
GACCTCTCAAATACGAAGTGACCCCAAAGACGATCCACCGGGAGCAATCGCAGTCGAAGAAGAGAAAGCCGAGACCAACGAATCGCCACGAGACGACGAA
CAAGTGTGTATATTCGAAAACGGAGATCTGTGGGCCGAAGAAATAATCCGAGGGTGGGCAATCATACCAGAAGTGGACCCCTCTTCCGAATCTACTGAGT
TGAAAGATATACAGATCCCTGATCCGGATGGGAAAACTCCAGAGAGGTGGACCGGCTACGAAAAATCATTTGGAAGAGACGACCTCTGGTGATGGGGAAA
GGTAATGCCTTACCGCCAGCAGCTCGAGGGGATATATGTGAAATTGATATAGGAAATGCAAAGCCTATTGCGCAACGCGTACGCAAATGGCTCCCCAATT
TAAGGAGAAGTTGGTCGATCTGATCAAGGGGCTGTTATCGGAGAAGATTGTACAGCCTTCGAAGTCACCCTGGACCAGCCCAATCGTTATTATTGTTGAG
AAAAATGGGGTGGACATCAGGCTATGCATCGACTACAGGTTGGTGAACGACCTGACTCAACTAATGGTCTACCCCATGACTCTGATTAATGAATTACTGG
AAGATTTGGACAAGGCATTATGGTATTGCTCATTGGATATGGCGAGTAGTTTTTGGGCAGTCGGTATGACTGAAAGAGCGAAACGAATCTCGGCGTTCAT
TACCCCACTGGGTTTGATTGAATGGATGCGAATGACGTTTGGGCTCAAGAAC