Description :
From Genome Similarity Track
Location :
Scaffold_2832:642- 2351
Sequence
1709 bases(100 bases per row)
AAGCCTGGCGTACAGCAACGCGCGGTCCATTCGAATAGTCGGAGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTC
GTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATAGTTCTTCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGAACCG
CGCGTCCGAAGAGAGAGTTCGCCTTGTGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAATATATCTT
CAACAACAGAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACACGACCGGGGAACCGTACGGGGTGTAACTTG
CCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTTAGAATGGGTG
AATGTGAAATACTCGTCTTCAATTTTTCGAAGGAACGACTTGCCACAGAAAGGCCACCTTCAACGGCAAAGTTCTCATCCTTGAGCTGGTACAGCGCCGC
ACCGTAGACCGCGAAGTCTTGAATGAAGCGACTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCCCGTTG
ATGGCCGCAAGCTTCTTAGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGCTGGCAGAAGATGCCCTTGGTGAAAT
TAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAA
CGACCGTCGACCAAACACAGGTACCAGCGATGATTCGTCCGGTTCCCCGTTCGTAAACACATGTCAGCGACGGGGCTGTTGACGGGTTGTAGTACAGGGT
CGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGACCCTTTACGTTCCTTGGCCTGTTCTTCGGCTAAACA
CATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGTCGCATTCTTTAAT
CCAAAGGGCATGCGCAACCACTCGAAGTGTCCGAGTGCGCAGACAAACACCGATACTTTACGTGCTCGAAATGTCATCATGACCGCCCAGAAGCCGCTTG
CTGCATCTAGCGAGCAGAACCATAGGTAGCGCTCGAGGTCTGTTAACAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGATAGCCTTCAC
CATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGGTTCTTTTTAATCACAATCACGATCGGCGATGCTCATGGACTATCTGAAAAGACGATCAGTCC
TGCTCGCAACAAAGCGCGCAGCAGCTCATAAAATTTGCCAAGAAATCGTAGCGGCACGCACCGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGA
CATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTCAGCGTCGCGACCAGACGTTCTCGGCG
ATCGGTCGA