Description :
From Genome Similarity Track
Location :
Scaffold_636:642- 2166
Transcript NameFunction/comments
Phypl_g9964Amino Acid/Auxin Permease (AAAP) Family

Sequence
1524 bases(100 bases per row)
CCGTCGCCAGAGTCGCGCCGcgcggccttcttcacgctcgAGGATGCCAAGACCATTTTCAACAtcgtgtgctgcttcttcggcaTCGGAACGCTGTCCA
TGCCGTCCAACTTCGCGCGTGTCGGGCCCGTGTACGGCACGCTCGCCATGCTCTTCATGGCGTTGGCCAACATCTACGCGACCGTGGCGCTCTCGCGCGT
CATCCTCGTGGCGCCGCCCTCGGTCAAGACGTTCAGCGACGTGGGCGACTGGGTGCTCGGCAGGACCGGACGCTACCTCGTCAACGTGTCCCAGCTGCTc
gtgtgtctgctgctgccctgCGCCTTCCTGGTGCTcggcagcacgctgctggacgtgctgttcCCGGACTCGTTCAGCCAGATCTTCTGGATCGTCTTCG
TGGCCGTCACGGCCGTCCCGGCGTGCTTGATCCCGACCCTCAAGGCCGCGGCGACCGTGGCGTTCATCGGGTGCATGGGCACCGTCATCGCCGACGTGGT
CGGTGTCAGCATCCTCGAGTGGGAGATGCGAGGCCACCCGGTCGTGCCGGCGCCGGACCCCTCGCTGCACCAGGTGCTGACTGCGTTCGGCAACCTGTCG
CTCGCGTacggcgtcgccgtgctCATCCCGGActtgcagcggcagcactcgcagcCCAAGCGGATGCCGCGCGTCATCGTGGTGAGTCTGGGCATCGGCT
CGGCGTTCTTCCTGGCGGTGGCGATCGCCGGCTACGTGGCCGGCGGCTGCCAGCTTTCGGCcaacctgctcttctccatcgtcaACATCTCGGACCCGTC
GTCCccgtcggcgctgggcttcgTGCCGAACCACGGCGCGGTCATCATGGCGTATCTGTTCATGCACCTGCACGTGGTCATTGTCCTGTCCACGGTGCTA
CAGCCGCCGTTCTACATGGCCGAGCGCCTCATCCTGGGCATGCACAAGGACCCCGTCGAGGCCGTCTCGGCCCAGCAGGACAAGCCCGAGGAGAACGACG
GCtgggaggagctgcgcgatAAGCTGTCGACGAACGGCCACCCCGTGACCAGCGTCAACGAGCGCGCGGCGAGGGACCTAGAGAGCAACGCCGGCTCGGA
CACCGAGACTCTGTCCAACTcggccaagcgcgagctggaggagaaggagcacgaCGAGTCCCAGCTCTCGGACTACAGCGGCTCGGCCAACGTGTGCCGC
TACGTGACGCTGCGTCTCGTGATCATGGCGATCCTGGTCGCGGCCGCCATCGGCTTCCGCTCGCACTTCCTGGACCTCGTGGACTTCACGGGCGCATCGG
CCATCACCGTGTGCTGCctcgtgctgccgctcgtgtTCTACCTCAAGGTCTTCTGGCGCGATCTGCCCATGTACGAGCGTGTGGTGGCGGTCGTGGTGAT
CGTGGTGTGCACAGTCGTGGGCTGCTACGTGATGATCTACGCCGGCAAGAACCTGTTCAACCCGGACTcggacagcgccacgttCCCGTACTGCTCGGAG
GAGTTCCAGTCGGACCCGTACTAC