Description :
From Genome Similarity Track
Location :
Scaffold_121:642- 1943
Transcript NameFunction/comments
Phyta_totarag4027hypothetical protein PHYSODRAFT_537381

Sequence
1301 bases(100 bases per row)
TAGAAGCAAAACGGCAGATGCGCATGAGAAGTATAGCGCTTGTGTGAGGCAAATGTGGAGATTCTTAAGGACCAGTTCGTGTTGATGAAATCTAAGCAGC
GACGCAACATGATGACGAGCCGTTTACTGTCGCTCCGTCGTCTGAATATTACGCCCGGTTCCTCAGTGTGCGGCGTTCCAGCCTGCTGGTGAGCTCTCTG
TTACTACGGCACGAGCTCCGTACCAGATCAATCCACCAACAGCATCCCAGATAGTGACAAGTGTGTCATTTCCGGGGGAATCCCAGCGTCACACCGAAAT
CTCTACGCCTAGCTCGGATGATGAATCGAGCAAGATCATCTGAAACGCAGTGTCAATCGGCTCTCCTCCTAAACTAGGTTACTCGGGTAACTAACGTGGG
CCACATTATTGTCACTTATGTTGCGAACACCAAGTTGACGCCGCAGTGTCGCAAGTTTTCCGCATCGAAAGGGGGGAAATTGTGCACAGTCGGGAACACT
TCGCcattcaagcagcagctgtagCAACTTCACCTCCGTTGACGATCATATAATGGGGCGGCGCAAGCCTGCCGCTTCAAAGCACGCGGCACTCTTCAGC
GATgagcgcgtcgtcgtgggcgtggacgacctggtgctgctgtcgtccgtGAGCGAGACGTCCATCCTGGAGAACCTCAAGATGCGCCACGCCGCCGACG
TAATCTACTCGTACATCGGCCACGTTCTGGTGGTCGTGAACCcgtacaagtggctggaCATCTACGGCGAGGACAGTATGCGCGCCTACATGCACAAAGC
CCGCATCGACGTGGCGCCGCACGTGTTCGCGACAGCCGAGGAGACCTACCGCACGATGCTCAGCGAGGAGGACAACCAGTGCGTCATCATCAGCGGAGAA
AGCGGCGCCGGCAAGACTGAGGCCTCCAAGCAGATCCAGAACTACATTGCAGGGGtcagcggcagcggcgccgGCGTCGACAAGGTCAAACGCACGTTCC
TGGAGAGCAATCCGCTGCTGGAAGCCTTCGGCAACGCCAAAACTCTGCGCAACAACAATTCCAGTCGCTTCGGAAAGTACTTCGAGCTGCTTTTCGACTC
GGCGGGGCGGCCACAAGGTGGCAAGGTGACGAACTATCTACTGGAGAAGTCGCGTGTTGTGAAGCCCGGCAAAGGAGAGAGGAACTTCCACATCTTCTAC
CAAGTGCTGGCCGGACTGCCACCCGCCGCGAAGCAGAAACTGTACTTGGATCGGGGTGGACCCGAGAGCTTTCACTACCTGAAAGCCAGTGGATGCTATG
A