Description :
From Genome Similarity Track
Location :
Scaffold_4:641951- 650100
Transcript NameFunction/comments
Aphas_H257_02984microtubule-associated protein, putative

Sequence
8149 bases(100 bases per row)
GCGTTGATCGATGAGATCGTTCCGTTCGACAACCTTAGCATCCACGAAGTCGAAGTGTTCTGGCGAAACTTCTTCGATCACGCGTCGGGGTTTGCCATGT
CCAAGCCAGAGTTCACCACCATGTGCATTAGCGTCGCCTGCCAGCTCAACAAATCGCCCAACCAAATGGCGCATGATGCTGGGGTTCTATTCGATGAGCT
GACTCGGGAATCTGACGCCAAGCTGCTGGACGCGCTCGAGTTCCTCGCGAGTATTGTGTTCATCTGCACTGCGCCACTGGACGACAAGATTGACCTCGTG
TACGACAGCTGGGATATGTCTGAAGACAGTATGTGTCGTCTCAACACAAAACATCGTTTCTAACCGCCTTGCCATATAGATGGCTTGCAAATCGACGAAG
TGGTCATTTCGGTACGTTCTCCATTGTCTATTAGTCTGCAGCGTTGAGTACGGTTTGACTTTGCAGTTGAAATCCACATTGCTCGGGCTCGCGAAAATTA
TTGTCATCGACGACAAGCACAAGACCATGGACATGCTGGATGACGAGCCCATCAAACGACTGGCCGAGATGGCCTTCCGAGACATGCTGCATGTATCCCC
GTCGACCCCCATCTGCAGCGACGACACCATTTCATGCGACGTCTTTCACGCGTACTGTCTCTCCAATGCCGACGTAAAGGACCTATTTGTGTGGTTTGAT
GCTGTCGAACAAGACAGCAAGCACAATGGCCTTGATCCGTTTGACATTCCCAACCGGTCGCTCAAACAAGTGCTGCAGATGGACCCGGACTCCGCCGTCG
AGAAGGACTTGACGCGGCTGACAACAGCCGACCACGGCGACGAATTCTTGGCTGTCAAGCCGTGGGAAGGCGCAATTGTCGCACCCTCCAAAGTACCGCC
GTTAGACGCGAGTGCGCCCGTACTAAGTCTGTCGCTGCACTGGATATACGGCTACCACGCCCAAGTAAGAAGTCAGCTGCTGGTTCCCCTTATCCACCCC
CTAACTCCATTTACACCATCTCTGCATATTAAGCCCTTTTGATGATCGTAGGACGCCTACGCCCGCAACAATGTGCGGTACTCCAACGCTGGGGAGATTG
TGTACACAGCAGCTAGTGTCGGCGTCGTCCTGAACGCCGGTGCGAAGACCCAGCGACACCTCCTGGCTCACACAGACGACGTCTTAAGCATCGCGATGCA
TCCGTCCAAGGGCATTGCTGCCACGGGCGAGACGGGCAAAACGCCCAAGTTGATTGTGTGGGACATAGCCGCGGTCAAGCCCTTGGTGACGCTGCGGGGG
TACCACTCGCGTGGGATCATCCAGCTGGCATTTTCGACGATCGGCAACGAACTGGCGTCCGTGGGGGCGGACGACAACCACAGCATTGGCGTGTACACGA
CTCGAGATATGTGGCACACGGCTGAGCTCACGTGGTTTGCCAAGGGCAACAAGGCAGTTCCCTTGCACGTGGTGTGGCACCCCACCGACGCCATGCACTT
TTGCATCCTCGGGGTCAAGTACATTGAATTTTGGGAAAAAGAAAAGTGCAATAAGGGAATCTTTGGTAAAAAGGGCAAACTGCAGCCGTTGCTCTGTGGC
GCCTGGGTCACCCTTGGCACCGACATGACCCTTGTCGTTGGAACGAGCGACGGGGCGCTGTACTTGTTTCAACGCCCCGACCTCCGCTCGATCGTCGAGA
ACGCGCATGCTGCGGCTGTACAAACCATGTACGCGCAAGACAAGACACTGATCACGGGCGGCAAGGAGGGCCTTGTCAAGCTATGGGTGGCGGAAAAGAC
GGGGCTTACCTGCCTAAGCACGTTCGACTGCAACGTGTTGCTGCACACAACCGGCGTGGTGGTCCAAAGCGTTTGTCTGTCGTCCGACGGGTCGATGGTT
CTGCTCGGCACCCAGTCGTCGGAAATATACGAGCTGAAGTACGTCTACCCAAGTGTCAATAATATATTTCGATTCCTGTTGAATGACGTTGTGATTGATA
GCGTCAAGGGAAACACAATGTCGGCGGCGCTCATGTGCGGACACTCGGTGGACGAATTGTGGGGCCTGGCAACTCACCCGACAAAGCAAGAGGCGGCGAC
GGTCGGGGACGACCGGTGGTTGCGCGTATGGGACCTCGTCACCAGGACTGTCCTGCGCAGCGTCCGGCTCGAGTGCATGGCGCGCGCGGTGGCATACTCA
CCGGACGGGAAGCTCCTCGCCGTGGGGCTTGGGGGCCAAGTGCCCGGCAAGGACAAAGCCAACAAGCACCCCAAGTGCGGCGGCGTGGTCGTGCTCGTCG
AGTCGGACTTGTCCAAGGTGTACGAGCGCAACGACACCAAAAAGTGGATTGCTGACGTCAAATTCAGCCCCACTGGCCGCACGCTCGCGATCGCCAGCCA
CGACTCGAGCGTTGTCTTGTACGACCTGACCAAGCAATGCGCCAAGAAACACGCGTTCAAAAAGCACAGCAGCTTCGTGTCGCACGTGGATTTCTCTGCC
GATGGGTCCTTCCTGCAGGTAGGTTTGTCTTCATATGTACCACCATGTATTTTCATACACTGAGAAATGATATGATGTCACAAAAATGATATGTCCGTGG
GACTTATGATATTTTAAGGCGAAGTTAGTACTACCTGACTTGCCCACGAAAAAAATGATATATAGTCAAATGATATGTCAAGATATACAAAAGTGATATG
TTTGTTTGGACGACGGTTCGAGTTTGACACTCGTGGTTGTGCTGATAGAGCATTTCTGGGGCGTACGAACTGCTGTACTGCGACGTCAAATCTGGCAAAC
AAGTGACCAGCGCGTCGGCGTTCAAGGACGAGCAGTGGGCCACGTGGACGTGCATCTTGGGGTGGCCAGTACAGGGCATGTGGCAGCCAGAGGCCGACGG
GTCCGACATTAACGCCGTCGACCGGTCGCACTCGGGGTCGTTGCTCGCCACCGCCGACGACTTTGGCAAGGTACGGCCTTGTTGCTCACTTGTAGGATGT
TGTGGAGAATATCGTTCTCGAGTACTATGCACTGGATTTTTAGGTCAAGGTGTTTCGGTACCCGTGTGTGCACAAACACGCTGGGTTTGTGGATTTCCTC
GGCCACTCGTCGCATGTGACCAACGTCCGGTGGTCTGCCGGTGACCGGTTTCTCCTGTCCACGGGTGGACAAGACCGGTGTTTGTTTCAGTGGCGACACG
ACTCGGCCGTCAAGCAGCCCACGTCTCCTCTCCAACACTCGTCAAACACCACCAACCACCACCACGTGTCACATGAACTGTCCACTGATGACGACGACGA
CGTGGAATTCCAAGTCGCCGGGGATGAATTCATGGCTGTTAAGCCGTGGGTTGGCGCCATCGTCCCGCCATCCGTCTTGCCCATGGTAGACAACGCCCAA
CCTCCTGCCACGACCTTGGCGTTGCAACACGTCCACGGGTATAGATGAGTCATTCGTATTTCTTGAATAAATGAAGTAAATGAATAAGTGTTCTAGGTAT
CAAGGCCAGAACGCACTCAACAATGTGCGGTACATGGAAGCGAATCGGATAGTGTATCATGCCGCAGCGCTGGGGATCGTGTTTGACGCTAGCAACAACT
CGCAACAGTTTTTCCAAGTTGAAATTATATCCTGACAATATATATATCTACCTGTCTTTGCACTTTTTAACGATATATATATGTAGGAGCACGACGATGA
CATTGTCGGGCTCGCTTTGCATCCAAATCGAAAGACGGTGGCCACAGGACAAATGGGCAAAGTGCCCAAGATCCACGTGTGGGAGCTCGGGTCGAGGGGG
AAATACGTGAGCTTGGCGTGCCTCCAAGGTTTCCACAAGCGCGCAGTTCCTGTCCTTAGCTTTTCCACGGTATACATATATATATAAATATACAGTATAT
ATAAAATTCATATATTGGGTTTCAGACTGTTTATGAAACCGAGTGTTTTGTATGAATAGGACGGCACGACGTTGGCGTCGATGGGAAACGACGATGACCA
CAGCATTGCCATTTACAAATGGAAGGAAGGCGTGCTGGTAGCGTCCTCCAAGGGCGTTCGAAACACGGTACAATTCTATCAATAAAATATCACATATCCT
TGTTCAAGTCCTATTTAAATATTTAATACATATATATATATACACCTACGAAACCAAATTTATATATTTATGACATAGTTGATGCATTTGACCCATTATG
CCGCGACGAATGAATGGATCTCGTTGGGGGACAAGACCATTACATTTTGGGCCGAACAAGGTCGGAACCTCAATGGGAAGAAGGCCATTTTGGGTAAAAA
TACTCCGACCCAGGTATTTTACTGCGCGATTGCCGTGCCCACAACTGGCAAACCGTCGTCCAAGCTGATTGTGGGGGCCCACGACGGGTCGCTGTACGTT
CTGGACGACAAAAACGTGTCCAGAGTGCTCAAAGCTCACACCGGCCCAGCGTACGCCCTGTTTGCCTCTCGTAAGTCTTCTGCCTACTTTGGTGTTTTCT
CAAGTAAGTTCAACATGGAAACATTTCAACGGTTGTTTGTTGTGTAGCCACCAAGGCCGAATGGATCAGTGGCGGAAAAGACGGCAAAGTGATCGTATGG
GATGCCAATCTAAGTGCATTGCACAGCTTTGACATTGCCATCCCGTTGACCAAACTGTTCAACTTATTACCCCCGGACGCGTCCAAGAAAGGAGGCGCTG
CCACGTCATCGTCGTTGTTTGGCGTGCGCAGCGTGTGCTTCAACTCGGAGCACACGCGGATTCTGCTGGGAACGTCTGGCAGCGATGTCGTGCAATTCGA
TCGCATGGGAACCAAAGCCACCGTTGTCACGCAGGGCCATTGCCAGGACGAGGTAATAACTTACTCCCCCCTCACTCACTAAAAGAAACTTCACATGGTG
CGATGTCGTAGCTATGGGGGCTGGCAGTGCACCCTGCCAAGCCCGAGTATTGCACCGTGGGCGACGACAAGACGCTTCGGGTGTGGAGCACGGAGCATCG
GCTTCAGCTGCGGGTCAAATCGTTGGAATGTGTCGCCCGGGCGTGTGCGTATTCGAACGCTGCGCCGTTTTGCATCGCGGTGGGATTCGGTGGTCGCATC
GGCAAGAGGAAGAAGCATGTGAAGGAGGGGGGCGTGGTGGTATTTTCAGCGGATTCGCTGGAGATTGTGTTTGAAGACAAGCCGTCCAAGGAGTGGATCT
CTGAGATAAAGTTTTCCCCCAACAATGCGACGCTGGCAGTGGGCAGCCACGACAATGCCATCTACTTGTACGCCATCCGCGACAATCGCTTCACCAAAGT
GACCAAAGTATTTCGAGGCCACAACAGCTATATCACACACTTGGACTTTTCCACCGACGGCAAGTACCTCCAGAGCAACTGCGGCGCGTACGAGCTCCTG
TTTTCCGACGCCAATACCGGCAAACAAGTCACGTCTGCGCGGAGCCTTCGCGACGTGCAGTGGCACACGTGGACGTGTGCGTTGGGTTGGCCGGTCCAGG
GTATCTGGCCCGCGTGCGCCGACGGCACAGACATCAACGCCGTCCACCGGTGTCATTCGGGGGAGTTGGTGGCTACGGGGGACGACTTTGGCCAGGTCAA
GCTGTTCCGGTACCCCGCCGTCGCCAAACACAGTGTCTCATATTCGTACGCTGGGCACTCGTCTCATGTGACAAACGTCCGGTGGCTCGGAAATGATACA
CACGTGATCACCACTGGCGGACTGGATCGAACGATCATGCAGTGGAAACATGTTCAGGTCGAGGGTCAGGCAGATGACAATAGGAACGACAAAACTCCAT
TGGTCTCCCCGTCCAAACCAGTATTAGCGACTCGAGACGAGGACCCTGACGAGGTATGCATCCGTACTAGTATGGAATTTGGCAGAAAATATATATGTAT
ATATGAAGAAAGATTCACATATTGACACCTCTAGGACGACGACGATGGCAAGCCATCGACCTATCATCATGCTGGGACCAAGAAGGACACTTTAGAAACT
GTCATGTTTGGCGCGGACGCGGGGGATGAGTTTATGGCAGTCAAGCCGTGGATAGGGGCGATCGCAGCGCCGAGTAACCCGCCCAAAGAGAACCCCCGCG
AACCAGAGCTCACCATGCGACTGGAATGGTACAGGAGGATGCCACGTCATTCATTCGGTCTGACGGGCATGGGGGTAGGGTGTTTGGCTACCAAACGGAA
CTGTCCCGCAACAACTTGCGATACAACGCCGACGGTCAGATTGTGTACCATGCAGCGGCCGTGGGCATTGTATATGACCGAGACACCAACACCCAAAAGG
TAAGAAAGGGCGGAGCTCACATTGGCGTATATTAACAAGGGACGGGATGCGCAGCATCATGTAGGCCACTCGGATGACATTTTGTGCATGGCCATGTCTC
CGTCGGGGCGGTTTGTAGCAACGGGGGAGCGCGGGAAGAAACCATCGGTAAGGTTGTCCAAGTCGTCGCTCGCGCCAGTGTGCAGTTGATTCCATCTTGC
CGTTGTTGTTTTCTAATGTTTCCAAAGTTGGTTGTTGATTGAGCTCGTTTTCAAAATGGTTGAAACAGCGTTGGGTTGTCCATAAGAAAAGGGTGAAGTT
GACCCTTTGGTGCGTGTGTTGATGTGGCTCGTAGATTCGCGTGTGGGATGCCAAGTCTGGCGCGACGTTGTGCGTGCTCACGGGGTTCCATGCCCGAGGG
GTAGTGAGTGTGACGTTCAGCCACGACGAAAAGACCATCGCGAGCGTTGGCGACGACGACGACCACAGCTTGGCGATATGGGAAGACAAGGGCGGGGCGT
GGAGCAATGGGCGGCTCGTGACAACATCGAAAGGCGATAAGAACGTCAACTTGTTTGCGATTGCATTGCCTCGGCAGGCATTCGTCACGGGCGGCGTCAA
GCACATTCTGTTTTGGACGTTGCAGGGGAAAACCGTGTCGCATGTGAAAGGTCAATTTGGCAAACTTGCGACGCAGCAACCGCTGCTGTGCGCGTGCAGC
TTTTACGACCAGACGACGCTCACTGGGGCCGACAACGGGGACTTGTACCATTGGACGGGCCACACTGTGACAAAGAGCGTCAAGGCGCACGACGGGTCGC
TCTCGGCGCTCTTCTCGGTGCTCCAGCCCGACAAATCGTACACGGTCGTTTCGGGTGGAAAGGACGGCAAAGTGTGTGTGTGGAACCAGTCGCTGCAGCA
AACGAGTTCGTTTTCCATCGACGCGAGTGGGAACTTGAGCAGCGTTCGGGCGAAAACCATCAAAAGCGTGGCGTTGGACTCGACGTTCAAGAAAATTCTC
GTGGGGACACTCAGCAGCGACGCATTCGAGGTCGAAGTGGGCACGGGGGCGCTTCTCAAAACCGTCGCGGGGGGGCACTTTATGGGGGAGACGTGGGGGC
TGGCCGTGCACCCGTTGGACCCGACGGCGTTTGTCACTGTCGGCGATGACAAGATCGCCCGCATGTACGACCGCCAAGCCAAGACGTCCGTAGTGCTGAT
GGAACTGGAGGACATGGCGCGTGCGATTGCATTTTCGCCCCATGGAACGATGCTCGCCATTGGATACGGGGGCGACGTGGGGCGAGGCAAGAAAAAAGGC
GGTAAAGTCGGGGCCATCGGGTTTTACGAACATCCGTCGACGACGATCGTGTTTGAAGACCATCCGTCCAAAGCTGCAATCAGGTACGCCCACCCGACGT
TGAAAGGTAGTAGTGATACATGGGAGTGTAGTGACGTCAAGTTTAACGCGTCGGGGACGATGGCGGCGTTCGGCTCCCACGACTCGAAGATCTATCTCTA
TGCAATTGACGCCGCCTCTGGAGGGATTCACAAACACAAGGTATTTGATGCACACAAGAGTTCCATCACACACGTAGACTTTTCACGCGATGGCAAGTAC
TTGCAGGTACAGTACACAACCCATGAAACCCATTGGTTCATAACGTTATATTGGTGTGAATCTCAACTTTTGGTAGTCCAATTGCAGCGGGTACGAGCTG
CTCTTTTGCGACACTACGACCGGCAAGCAAATGAAGTCGGCGCGCGCGCTCAAGGACGTGGTGTGGGACACATGGACGTGTGTCCTGGGGTGGCCAGTGC
AGGGCATTTGGCCCGAGTTTGCCGATGGCACGGACGTAAATGCCACGTG