Description :
From Genome Similarity Track
Location :
Scaffold_201:6419- 7718
Sequence
1299 bases(100 bases per row)
CTCGACTTCATATTCACCGGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCATGCTTCATTAGTCGCGTCAAGT
ACCAACCGAGTGTTCGGTCGACTGTTGAGCTCGTTGACAGCCTTAAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTT
CCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGTTCCAT
GTACAACCACGCCCGGCTCTCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTCCTGAAGCTTTTAGGGGGTCCGCCGAGTGT
TCGTTTCCACTTGGTTGGGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTT
TGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACAT
TGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTC
TCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCT
GTGGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCGTAT
TAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGACAATAACGAATCCC
GTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGG
CTAGCACGTTACCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCGGCGTACAA
GCTGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTG