Description :
From Genome Similarity Track
Location :
Scaffold_1389:6417- 7740
Transcript NameFunction/comments
Phyag_g10484hypothetical protein PHYSODRAFT_462863

Sequence
1323 bases(100 bases per row)
ACCTTGGTGGTCGTGCCAAGAGTTGGGCGTACACGCGCGAAGCGACGTCGCCAGGTTGCTTTGCAACTTGGGCACAGCTGTGTGAACAGCTTCGTGCCGC
CTTCCTTCTGGCGAACTATGAGTATCGTCAGCGGTCGCGCTTCCTCGCCTGCAAGCAAGGGAAGCGTGAGGTGCATGAGTACAGTCAAGAGATGCGTGTT
CTGACTGCATCTCTGGTGGGGACTCCCCTACCCGAACACATCAAGGTCACCGTGTTCATGGATGGCCTTCGGGTAGGCCCGGCACGCACGCACTTGTTCC
GCGTGCAAGCCAGtacgatggaggaggcgatCCAAGGCGCCCTCCAGGAAGAGTGCAGCCACAAGCAGGCCCGAACCccggctgctgcttggaACGCAGG
CAGCTTTCCGAACACCGCAGTAAGCGGCGGGTTCAATAGTGGACCAATGCCGATGGACTTAAGTCTGGCAGAACAGAGCGACATCCGATGATTTGGGTGT
GGTAAGCTCGGACACATGCAACGTGTCTGGCCCAGAGGGGGACAAAAGAAGAGATGCTCCTCTCATTCCCGGGGTCCAAGGGGTCGCTGGCAGAAGCCGC
GACCTAAGTGACAGGGGAACGCCGGACACCAATAGGGGCGGGGCGCCCTACTGGGGAAGAACTGAGTCTTCATGAGAGGTGCGCACCATGGAGGCTTAGC
CCCTGAGAGTCTGTGCACCCTCGAATCGGAGAACGGCAGCGGTGGGCTGCTTGTAGTACATGCGGTTGTACGAGGATACGATTATCCTTTAAGAGTTTTA
ATTTACTCTGGGGCGTCGAAGAATTTCGCGCGCCACCGGTGTGTCACGCGTAATGGCGACAAGTTTACCGATGCTCTGCGAGAAAGCAAAGGCACTGGTC
TAGTCTCGGTTAGACTGGCCAGTGGTACGGTGGTAGAAGCACCAAAGATCCACATGGATTTGAATGTGAAGTTCGAGGACTTTGACAGCTCTGAGCCGTT
CATCGTCCTTGAcatggacaagtacgacTTGATCCTTGGCATGACGTGGTTAGAAAAGCATGAGCCTTGGATCGACTGACGTGGCAAAGCCATAGGGGCC
AGTAAGCCGTCAGCGTCTGACGGAGCTTTGGTGAGTCATGTTCCCACCTCTATCAGATGGTACAGCGCCCGTGAGGGTGTCAGGGGCGCTGGAGCGTCCG
AAGGAGTCGTCGATGAGACGAACGGCTCCAGGGAAGCAGTTGCAGTGGGCTCTGCAACAGGTCGTGAGACCTCACCTATCGCGAGTGAGACTCGTGGGCT
GCCGAAGGTTAGGTTGATCGGTa