Description :
From Genome Similarity Track
Location :
Scaffold_13:64166- 65988
Transcript NameFunction/comments
Phyci_214481isocitrate lyase

Sequence
1822 bases(100 bases per row)
GCGGGCCACAATGACCAGCGGACTGCCGAGGATGTCGGCCTGCAGACGAGCAGCGATCAGGCGCTGGATGTGCTCCTGCACGGAGACCAGCACCTTGCCG
CCCATGTGGCCGCACTTCTTGGTGCCGGGCTTCTGGTCCTCGAGGTGGATGCCAGCGGCGCCGCGCTCGATGAACATCTTGGTCAACTTCATGACGGCCG
TGAGGCCGCCGTGGCCGGTGTCGGCGTCGGCGACAATGGGGCGCAGGAAGTCCGTGGGCGGCGAGCGGGCGCGCTCCTCGGCCGTCATGCGGCGGCGGGC
CTCGTACTGCTTGCGGTCGTGGAAGAGCTGCGCGCGGAAGAGCTGGTCCACCTTGTTGGGCACCGTGTCCATGGGGTAGTCGGCCACGTCCGGGCCGGGC
TCGTTGGACGTGGAGGCCGTGGACGACGACTGCCAGCCGCTGACATAGACCGTGGACAAGTGCTTGGCCATCTGCGTGACCTGGATCGTGTCCAGCGCGC
CGAAGGTGTGGCTGGTCTTCTGGGCGGCCTGCAGCTCGCGCAGCATCTTGTAGAGCTTGCGCGACATGGCGGCGCCGGCGTTGGCAGCGGGGATCGTGCC
CTGGAGCTTCACCACGTCCTCGGCGCCGTACGGGCGCTTGACGTAGCGGAAGCGCTCGTCGTTGACGAAGGCCTCCACCTGCTTGACGCGCTGCGCGTAG
GCGCTCTCCTCGGCGCGCGGGTCGTGCGAGCTCAGGTGGCTGGCGATCTGGCTGATGCGGGCGTGCGGGGCGCTCATGGCGGGCGGATGTGGCTGGGGCT
TGCGGGGTCGCGCTTCGGGGGCTGCCGGCAAATTGGGAACTAAGCCTCCCAGCAAGCCTAGCAAGCAATCTTTGGCCGTGGCGGCGTGTGGCAACTTGCC
GCCGCGGCGACTCAAAAGATCAGAGACTGAGGGGTCTCGCCTCGCCATTGGCCAAAAACCAGCCCCGCCGTCTACGCGCGTGCGTCGATGGTGCAGAGAA
ACTGCACCATACTGAAACCAAGTCACGTCGGGCTTGTCCGGGCGGCGCGCTCATATTGCGCGTCGGGAGCCCGACGTGGAAGTTTCATCGCAGATGTTGA
AGCTGCTGCGGCCCCTGATGGTAACGTACACGCAATGCAGGCCAGCACTTGCCGGGGCATGCAGTAGAAGTTGCCTACAGCTACAGAGGCCTCCGGGCAG
CTGGACATAGCGCTTGCTTCTGTTGGTAGCGGCGACTACTCTGTGCGCCTACGGCGCCGCTCGCCTTGGTGCGGAACCAGTTTTAATAGCAGTCGCCTCA
CGGAGCGCAAGTCGAGCTCGGCGTCAAATCACACCGACACCTGTCGCTGTATTCCGGTGAAACCTGGCTGCAACCCTTGTGTTTCACGCGTGACGGCCCA
TCTTGAAGCCGAGGGTGTCGACACGGCATGGTCACCACTGTTAAATGGCACATGTGTCGGCATGCAGGGTGGTACGGTTACCGCTGTCTACGAAAGCAAG
TTGCTGGTTGCACAAACAGCAGCTCGTTCTTGTGGCGTGCTGCGTTCGCTTTCACGCCCCCCTGCTCATCTTGAGCTTCAGAAGTCGCAGTAAACGAATC
CCTTGCCAACCGACAGGACACCGAAAGCCCGTTTGTCGTCGCTCTGTTGAATTGCTGTCTTGCCTTTGTGTACTGCGGGCGAATGCTGTGTGTGTATGGG
GGGGAGGGCTTGCTGTCGCGGTGAGATTTTGAGTCCACCAAAAATCAACACGTGATATTCGAGACTCGAGAGACATCTTAGTCGCTCGATTGGGGATTTA
TAGGCAGATCCATCACGCGTGT