Description :
From Genome Similarity Track
Location :
Scaffold_5:641594- 642682
Transcript NameFunction/comments
Phyci_154124ubiquitin family protein putative

Sequence
1088 bases(100 bases per row)
cagcagcaggaacagaagcgggagcagcagcagcgggaccaggagcaggagcaacgggggcaggagaaggaactgcagcaggtgcaggagtaggaacagc
agTACTGCCAGCGTTGGCTGCATCACCCGCAGTCGGCTCGGTCGTGGTCGCGTCTCCAGCACCTGCTTCAGCCGAGCGTCCACTCAAGCGGTCACGCTCT
GCGAGCGCAGCAGGGAGAAGTCGAAGTCGTGGTCCGAAACGCTCCAGGAGTGTCAGCAGCATTTCCACCTGCTGCTGCAGCTCCGTCATAGCCGCATTGG
CATCTCCTTGCGGCAAAGCAGTAAGCTCGGCTGGGAAATCGAGAGACGCGTCGTCCAGCGTCGCACGCACCGATTCGAGTCGAAGCCCCGTGCGCGACCG
CAACGCCGCCTGTCGATCAGCACTTGAAGAAGAACGTCGGCGCTGACGTCCTCCAGCGCCCGAGCCATCGCGATTCCGGTGGTGGTGGCGCTGCGTTCTC
GCCGCCGCGGCTTCCATCTCAGCAGTAGCTGGTCCGCCCAGCGCTTCACTGGAGAACGTAACATGGCGGCGTCCGTCCGCCGCCGTTCCCGTTGTCACTC
CGTCTCCTGCGTCCACGCCGACGCCACCTTCACTGACCTGCGAGACCAGGTTGGCGATCATCGAGCTGAGAAAAGGCATGGTCACATCAGCGCCTTCAGG
CACCGAGATCGTCGCGCCCATGAGCAcgcggcccggcagcgccgcgcccgcgcccggccgccccATGGTCGGGTCCGGTTCGTCATTATCTCTCGGAGGC
GGCGGCGGCGAGCGCGCTCCGCGGCGATGGCGCGATCGGGACCGGAGGCGGCTCCTCCCGATCTCGTCCAGCCGCGCGTCCAGCGCGTCGATCTCGTTCA
TCCGCACGTCCATTTGTTCCAGCCGCGCGTTCATGTCCACGGCCGAGTAGCGGTAcggggccggcgcgcgcgggcccAGGCCTGCGTTCGGGGCCGGCGT
CGAGCCGGAAGGGGCCGACGCCTGGCCGGCGTCGCCTTCCACCGGCGGCAACGCGCGCACGACCAAGTGCAGCACGTGGCCGTCCTCG