Description :
From Genome Similarity Track
Location :
Scaffold_30:64144- 66710
Transcript NameFunction/comments
Phyca_LT1534534939Hypothetical protein

Sequence
2566 bases(100 bases per row)
caatgacagacgtaccatctccttagtaaaaaggaatcggcctgggaccgagaacttgtcaccgttgtcgtattgcaccatgtacttgtcgtcatccacg
cgacttaggacctccccacgcacaaactgcgcgcagttctcacccactgggaatttagaatacaggatcgagccaactgcaaactcatcacattccggag
cccgcggctgcgcagatactttcgtttcattgcaaattgccaactgggtctcgctcgagctagtaatgacggagggcaaactcgcgggttcttgtccggc
tattggcgaacgaggaccacttgcaccctcgttgggggctacaatagtagagattgcagtgctgtacggcgtcataacctcaacagacatgtgcgtaaat
acaggaaccttgtacgttgggatgacctgctcgtccaacgtatttccagtgacgagcacagtgacggcttcttcaggctgtggttgtatcgcttgctgat
ctggcatgaccacgacaccacccgaagcctcctctatcgttgacacgaacttcttcatcacgtcctgcattggcccatttagttgctgccataatgcctt
aaactcgcgaatcaggacttgacgcaccgacatgggcaggatcgactgctttagctcccacaaatgctgctggccctcagcaatctccataatcacctgc
atggagctttgcgtcacaccaataaactcacggatgcgcctctcgatgtctcctttcttgatcggggccgaatcaccgaagtactcgatgtgggcctcta
aagccttctccagctcctgctgttcctctttggccttgagctgttggaccgagtagaacgtgtagtactggtgcagcgcatgcttgagcatcggaatgct
tttttccagcgccactgtcgcgcggtttattgaagttgtttgtgcttccttgagcccactagagaagctcgtaagcgacgcctcgcgccgctctcgaact
ttccgaaacaggatacacaggttcttgtggaacgctagtgcgtgctcggcaactttcactgataaagtcgatctcttggctctgtcctcgctgtcactcc
gcgacttccaaagcgctttggcttccacatcgtccttgctccacacgtcaacgactgacatgagtcgtgctgacgcctgcgtctctcctgcccccagaag
ctccttctcacgaatatccacaagctggacaatctgcaaggtccgtgtttcctgtatttgcttggcgtctgctaacgagcgttgcgcctcgttgacatct
tccgtgcacgttgccactaggtcgtccaacttctgacctaaagttttgatagattcctccacttccaccttttccttggttttagtgtcgaacgactgag
caaaccaactcaatcggtccatgtacgccttgcacgcagaagaaagacactcgatggaccttttggcgacttttgcgcgatcaaacgccttcatctcagc
gctctcgtcctcggcttctgcaatagccgccacttcttcatctatcttcgacagaccttcatcattcgggacgcatgccacagcatcttctgcgccggat
gaaactggaggtagcttctgtgccacctcgacaatcaatgcggccactcgcgtttgtatttcttgagcgttgctcgcctccagatccttcacccaagtgg
ccaacgaatccaccgtcaggttcaactgcattgccaactccagctctgcaggcacctccagactcgcccacacaccgttcacccattccggattacgcag
aacctgtctcgcagccacacggtcctccaccgtctccagcagcaattgctgtgctctggcatgacctacaggaggctccatcaccatcgcgacgtcttgc
atctccgtgtcttgctgcgtgttgggcgtcgtatctttttctgcgtcttcctcttctttctcctcagtcatgtcgactacgaatgagtcctggtcctttc
ggcgtttgctgggcgtgtcttcctccgacgcaggcgacacactaaagcggcgtttctcacgcacacgctccggtttcctctgcatcatgtaaatgctggt
cgacgctgcaggggccgacgccgggatactaattgtgcgttgcttgtggcggcgactggcctgcagatacatgtatgcgtcttgtgtgcgataattgcag
gcgcgcagcgcttccaaaagctcctggctgctcaatggcgggtcaaattcgttggaagccatctgctcgagatcgcgaacattctgtgcgctgcgaggct
gcccccaataggagtcgtacgtccccgttcccatattcttcggtcaaggttgagtagaaaaaaggaaatatattttgtgtcaatacaaatatcaagataa
aaactatacacgatctaaaaaactttagaaagtgccttctgtttcctcgtcgtcttctttctcgagctggtgcgagataacggctgcaacgcaccatttg
tcgtcaagagggtctttctcgagctgtaagatagtatactgacccaaccgcagcgagcctgcaacc