Description :
From Genome Similarity Track
Location :
Scaffold_785:6414- 10267
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_785-snap-gene-0.5Cytosol aminopeptidase
Pytar_ATCC12531maker-par_contig_785-fgenesh-gene-0.3Flagella-associated protein FAP196

Sequence
3853 bases(100 bases per row)
CGGCTCTTCAGCAGCGCCAGCGGCGTCTCAGCGCACCGCCTCGTGGCGCAACGCGTACAGGGAAGTCTGTCCCTTGCACCACAGTCCGCTGCCGCCAACA
CGCGTGTCGTATTCGTCACCAAGGAGCAGCGTGACGGTGGCGACGCCGCGCTCGCCCAGGCGCTGCCCTTTGCCGTCTCGCCACACGCGCTGCGCGAGTT
CAAGGCCAAGCCGCAGGAGAAACTGTACTTATACCCAAGCAGCGACGATGCGTCCCTCGCGGACCAGCGCGTCGTGCTCGTGGGCCTCGGGGAAGAGAAG
AAAGTGGATGAAAACGTGCTCCGCAATGCGACCCACGGCGCCATCTCCACGGCGCGTGCCAAGCGCGCAAAAGACGTCGTCGTGCAGCTGCCAGCGCTTG
CCGCCGACCATGAGAAACTCACGCCCACACGCGTGGTCGAAGTACTCACACAGGCGTCGATGCTTTCGAACTACCAGTTCGACAAGTACCTGAGCAACGA
GAAGGATGACAATGGAGAGCCAAAGCTCAAGCTGCCGCTCGAACAGATCTTCCTGGACGCGAGCGTCGAGTTCCAGCAGGTGCGAAACCAACACTGCATT
CTATAGTAGGACAGGAACGCTCACCCTCGATTGTGCTCTGTGAAACAGCACGTCGAGGAGCAGATCACAGTAGCCGAGGAGACCATCTTTGCCCGCAACC
TTGGTACGTCTGCTCTCTCTCCCACCGCTCGCACTGCGTTGCGGCCCTCTTCTCACTGTGAATCTCCATTACCAAACGTTAGGAAATGAGCGCTCGAACG
TCGTGACGCCGGCATTCATGGAAGAGGTCGCTCGCTCGTCGCTCGAGCTGCCCAACATGTCCATCTCGGTGCTCCAGCAAGAGGACCTGGAGAAGCACGG
CATGAACATGTTTCTCGCCGTGGGCCAAGCAGCGGCCGTTCCTCCACGGCTCGTGATTCTCGAGTACAAGGGAAACCCCGAGGCACCGGACGACAAGATC
GCGCTCGTAGGCAAAGGCATCACGTTTGACACGGGCGGGCTCAACCTCAAGCCCACAGGTTTCATCGAAGACATGCACACGGATATGTGCGGCTCGGCAG
CCGTCCTTGGCGCCGTGCGAGCGGCCGCACGTCGTAACCTCAAGGTTAACATTGTGTGTGCACTCGCGCTCGCCGAGAACGCCATTGGCTCGCAGGCTAC
CAAGCCCCACACCATCATGAAGTCCCACAAGGGAATCACCGTGGAGAACAACAATACGGACGCCGAAGGACGCCTCGTGCTGGGCGATGCGCTGTCGTAC
GTGCAGCAAACGTATAAACCAAAGACGGCCATTGACGTGGCGACGCTCACGGGCGCTTGCATCGGTACGGCCCTCTCTCTTTCTCTGTGGATTTTTTCCA
CTGCGATCACTGACTGGATCTTGATGTGTGTCTTTACTTTTGCCAGTCGCGCTGGGTGAGCACTGCGCCGGTCTTTTTTCCAACTCGGACGACCTTGCCG
CTAAGCTCCTCGTGCGTTCTCCAACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTGCCTGAGCACACGGAGGCACTCAAGGGCAC
ACAGTCGGACTCGCGCAGCACGAGCAAGGGCCGCTACGGCGGCGCCANNNNNNNNNNNNNNNNNNNNNNATTGCCGGTCCGTCCAACTACAGTGCCGCCA
AGTCGTACTTTCCCGCCGGCGCGACGGGCTTTGGTGTGCAGTTGCTGTACAGCTACGTCAAGCACCACGAGGCCAAGCCGTAACTGAGATCTCATCCAGA
GCATAAAAAGGCAAGCGCTAGAGTACTAGGCGGCGTATTTTAGGGGGTGTAGACATTCCACACGAATACACTGCCGTCGTCGCCCACGGACACAAGTTGC
CTGTCGTCCGGACTGAAGGCAAGGCTGCGCACGCTGCCCGAGTGGCCAACCCCGTCTATGAGCAGATCCCCCGTCAGGAAATCCCAGAGCTTGACGAGAC
GGTCATTGCCGCCCGTGGCAAACACCCCCAGCGAGTGGGCGACAGCGAGGCATGTGACCTCTTCGTCGCCGTGGGCTCGTTGGATAACATTCACGGGCGC
GTCGTCGATGCGCAAGTCCCAGAACGAGATACGCTTTTCCTGCCCGGCGCTGAGCACGAGCTGCTGGTCGCGAGAGAGCGCGACCGTGTTGAGGCCGCCC
ATGCGCTGCGTGTGGCTCGACACGCGGCGCTCATTGCGGAGATCCCAGCACAAGATACTTCGGTCGCGGCTGCACGATAGCACGTGGCGATCGTCCTGGA
ACAATGCGAGTCCAGTCACGGCCATGGCGTGTTCCTTGAGGTGCGAAACTAGGTCGCGCTTGCGTAAATCCCACACGCGCACGTCGCCGCACATGCCTGC
CGACACGACGAACCGCTGGTTGTGGCTCAGCACGAGCGCCGTGACGCCGCCTGTGTGGGCGCTGTCGATCGTCCACACAGCGTCGCCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCCAGCCAGAGAGCAGCACGTCGAGCGAGAACTGCAGACACGTGGGGTATCCTGCATCGGCCAC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACGCGTCCCAGATGCGGAGTGTGCAGTCGCGCGAGATGGTGGCGAACCGGTCCGAGACGCCCGCCGC
ATACGCCACTTGAATGACGGCGCTCGAGTGGTTGCTGAAGAGCATGCGTGTCGGCAGGTGCCGCTGCTGCTGGTTCGGGGGCGTCACGTGGACGAGGAAA
ATGGACCCGGCCTGGGTGCCCACCACAGCTTCCGACTGCGACGCGTTGAGCGCGAGCCCCGCGACCGGCGCATCGAGTGTCGTCATGCTCGAGTCGACAA
AGTCGCTGGTGAACTGGACCACTGTGCCATCGCCGCCACCGACCAGCACGCCGTTGTGCACGAACACGATAGAGTTGACGCCGCACGAACACGCCGGCAC
GCTCTTTAAGAGTCGCTTGGTCTTGACGTGGACGACGGCAAAGTCGCCGCTTGTCGAACCGGCCACGAGCGTCTCGCGGTCCGGAGAGAACGCGAGACAC
GCAAAGTCGCGCACGACGGTCTGCTCAATCTTGGACGCCACGAGCTCGCCCGTCGCCGGGTTCAACACCCACAGCTGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTCGCAAATTGGTACTGGGCCGTATCGCGGCGCTTGACGTCGCGTGCCATGCCGCCGAAGGCCACGGCCGT
CGTCACGCTTGCCGATAGCTTTTGCTGCGTCGCGCAGATCTGGCCCGTAAAGAGATCCCACACATACAGGCGGCCATCCTTGGGGGAGCCGATTGTGCAC
AGGAGTCGCTCGTCGTCAGAAAACGCCAACGCCGCGATGCCGTGGTCGTGTTCTGAGAGACGATACACGAGCTGCTTGGTCCCGTAATCCCACACGAGTA
CGTCGGCGCGACGCCCGCGTTCGCCAGAGGCGAGGAACCGGCCCGACGTTGCCATCGCCATACACGAGATGGCGGCGTCGTGGCCACGCAGGAACGCCTG
ACTATGTGCGTCATGAAATGCCGTGCAGAGAATCGAGCCGCCGGCCGGATAGAGATAGTCATGGCCCAACGGATGATAGAAAATCGAGTTGGGCACGGCC
GAAAAGCCGATCGTGTGCTCGAGTTCGATCACGATCGAACTGCTGGTGTCGGG