Description :
From Genome Similarity Track
Location :
Scaffold_152:6411- 8770
Transcript NameFunction/comments
Phymu_g5598conserved hypothetical protein

Sequence
2359 bases(100 bases per row)
ttccgacgacgacgtgcgcGACTGGTACGTGACGCTGCTCAAGGCCTTGTCGCTCCGACTCAATGAGGAGACAGTGCAATTCTTCCTGGACACACAACTA
GAGGGAGAGGATTTCCGCTTCCCACTGTACGCGCGGGCGTTGAGGTTCGGTCGATGCAACGAGACGATGGTGAAAGTCGCAGTCAAGACGTTGACGCTCA
ATGTGCTCAAGGTGCCGGACGCCAGAGTGCGGAGCTTTGTACTGCAGTACGACGACTTGAACTACTTCCGAGACATTGTGGAGATCGCCAACGACCTCAC
GCTGAAGCTTCAAGGGCTGTTAAATAGTTGGCCGTCGGCCGAAGACGCATCGGAGCGGGCAGCTACGACTgagaaactggaggaagcagTGGATGCTTAT
ATTGACCACTGTTTTTACTTACAAGACCTGCTGGATGTGAACGTGCCAGAACTCTGCTATAAAATCGGAGACTTGCTGTTCTCTCGACATATCAAGTGCC
TACTAGCGACGAGTATTCTTCCAGATTGTGGACCTCCGCCGCAACGTGTATCGACCCAATTGGCATTGTACCTGCTCACTAGACTTCTGGGCATTTTGGA
GCACACGCCGCTCGTCAACGCTATCGCGTTTATGCTGTTGTCAATGGATGCGACGGAAGACTGCGAATACTCTGCGGTAGCGCTCGGAGCGGGATCAAAA
CGGCGGCGTAGCAGCTCTCACTACTTGGAAACTGTGGACAGTaacgatgacgaagaggattCAACAACAACCGACAACTCGCCTCGACCACAATCTCCAC
GGCCTTCTCTACGATGGGATAAGGAAGCGCCCCCGATGCATGTCTTCCGCCCCCATTCAACAGTCACGTGCGAGTCGTCGTTGTGCTACGTTCAAACGCG
GTTTGCCATGGGGGAGTGGCCGGTGGATGAAGTGAAAGCGTTCGTGCCCCAGGGCAGCAACTGTTATCGTCAGTCCTTGCTCTCATTGCTTTGTTCCAGT
GACGAACGGCTCTCTTCGACTGTGGTTATGCTTCTGCTAGCGATTGTCAACAACAAAGCAGTGGATCACTCTCTGTTACGGGAATTGGATCTCCTACCGT
TTCGACATCGTCACGGGAAAGCTGTTGACACTGCTTTGAATGATGATTCTGCAACTGGGAAGGGGCCGAATGGTGAAGCCCTTTCATCTTCGTGCACTTC
TTCTGGTTCACAAGGAATGGAAGAAGATACTGAGAAAGATGCCGCTGTCACTGAAGACGTGCCAAGTGAAACGGAACCAGACAAGGGAAATGCCTACCCT
TACTGGCTAGTCGAGCTGGTTTTGGAGGTTCTAGCGCGGAACCAAAGCTCGCGCTTGCTTAGCGTTCAGTTGTGCTCCCGCTTGCTGGTGGACATTATGG
TGGACGCACGTACATCATCTCGCCACTGTCTTGCTAAGGCtcactctgctgctcttAAGAATATCCACTCGAGCAGCGCACACCTCGTCATGGAAAGCAT
GCGCGGAGCTATGGCTGAAGTGGATTTGTTCATTtacgtgctggagaaagaggTGGCAAGCTTCCAGCGCAAGACTTTCCCtatggagctgcagttggat
TCTTCGTCACCTTTTGAGTGCCTCATCCCACTTGGAAAGGAGGAGTCTACAAATCCCCCGGTGTGGGCAGGTTCACGAGACTCGTTAGCTCTGCGTCGCC
CCTCGAATGAAATGGAAGTGTGTCGGAAATCCATGCAAGTCTTCCTTTCACTGCGGAAATTGCGCAATTTACTGGACAAAAGTTTCATAGACGACGGATT
GGAGCAACTGGTTGTCTATCGTCATCCGCGTACGAGCGTGCTAGCGAGTGCTGCGGGTGGAAAAGGCTCATGCACAGCTCCACTGGACGGCATGGTATCG
CTGAGGTGCATGTACCGTGAACAGCGCTTTCTGCTCATGCCCACACGGCTACTGATGGTGATGAATCCGGAGGCATTTGTACTCGTGGAGAAAATCCCCG
AGCAAAGCGATGATGGCAGTCCTCATGACGGAGAGGGCGAGGGCATTGTGAAAGTGTTCGCGCCTATCCACCGCACATACTGCACAATGGATTCAAGAGA
TGACCGAGTGCTGCAGGTTTCTGTGCGCTCTGTAGCACCCGTGCCAGGGTGTCGCAGTGCTCTTAAAGACAGGCAAGAGGCGTCAGCTTCCGGCAAACTG
ATGGACTGGAACGTATTGCTCATGTTCTCGACTTCTGAAGACTGtgcacaagctcaagctcacATCAACATCAGTGGCACGGAGGTGCGTGCATTCAAGC
TACACCAGATCGAGGAGAGTCTTACAGCACATCTCCAAGTGACTCAGTCTAGCAATGGT