Description :
From Genome Similarity Track
Location :
scaffold_419:6410- 7962
Transcript NameFunction/comments
g8185.t1hypothetical protein

Sequence
1552 bases(100 bases per row)
CGGGAAATGATGCACCAAAGATGCGATTAAGATCTCGACTACGCGCCCGTTCAGTTTTTTTTAGGAATCCTGAGTGTAGATGCTGTGATGGAAAATGTGG
TTTCCCTATGTAATCGCTTGCTGTCGATTGTCGACGTCTAGCCACGAGAGTGTGGGAAGTGGTGGAATCCCATCCGCTGAGAACACGTGCAACCTTCTGG
CCTTCACTGGTAGTATTGAACACGTACGCGAATGCTTTGTTTGTCGCTGACATATTCCACGAACCTCGATCAAAAATGCACTGGGCACTAAGCAGCGGGT
CGCTGTTGGCATGTTGGGCCCCGCCACGTCGGAAAGAGTGAGAAGTCAGGTTAGCAGTTGGTTTTGCCTTAGCTTGAGCTCTTGAAGCAGACTTGACAAC
ACGATTCACATAGGCATGAGTCTTCATATTATTCGCTGGTAGTTTGCGTCGTTTTTGTGAAGGCTCGCTGGAAACTTAGACGGCGTCATCACAGGCCTGC
AAAGCTTCCGCTAGAGGTATGTCTGCTAAAAATGCTGTGTCATCATCACTCTCCGTAGATAAATGGGGGTGGTCAAGTAGTTGCGCCCCTGGGGAATCTT
GCATCACCAAGGACATCGCAATAGCATGAATAGGACGCGTGATGAAGCTGTTCTTATTGGGGGAAAATAATTCCCTGTTCATCCGCTGTCTTAACGCGGA
TCAGACGAACGAAAACAACCCCGTCTGCACTGACCGATAAGTTGTCCTTAATAACGAACCCTGAGTCTGAGGCACGGCCAAAGGCGTACCACATCAACGC
CAGTAGAGCAGCATCTTGGTAGTCTTTAGGACTGGCAGCATCAAAGTAAAGCCCATCCATGAGAATACGGAGGTCCTCCTTCGTGCAAGCAGGCGCTTTC
TTTACCATCCCGCCCTCCATGCGCTTCAGACAGTGACGCTCGAGTGTCTGGTTCATCTTGAGTAACTTTTTCTCGATGGCAGCTCGATGTGTCGGATAGG
TATCGAGTAGCCAATTCTTGACATGACGGTAGTAGCTCATAACAGAGTTTTTTGCCAGTAACTTTCCTCCTTGGCCCTCAGCGAAGGTGAGATGAATGCC
GAAACGGTCCATGAGCTTCAGAAACACAGTTCCAGTTGCATCCCCGAGAATAGACGCAGAGATGAATCCCATGGAAACACCTTCGGCAGCAATGAACCGT
TCAAACGCGTGGATAGCTGTTTGTAGAGCTCGCTTCGAGTTTGCTGGTGCAAGGTCTTGAAGACTCATACTGATTCCGAGATATCTGTCGGCCGGAGCGC
AAATATGCGAGTGATGTGCGCTGAACTGGTGGTTTGTATAGCCCCTCAACATATTTTTCCTCCCTACCGACATTATACGTCGGCACGATGTCGGTGCCAA
CTTAACCTAACCCTAACAGTGTTGATTGGCCAGCTCTGCTGACTGTCTAACCTGATTGGTCATTTACCAAATAATGGGATTGTGATAGCATACATTGATC
AAGATAAAATTGGTCTGTCGGCACCGTGATGATATTCATCCATAGCGTACAA