Description :
From Genome Similarity Track
Location :
Scaffold_632:6410- 7638
Sequence
1228 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAACATTTTTCATCATCGGTAGATAATCGCATAGGAAGGCAGTATTCATCTCGTTAA
ACCAACTTCTGGCACGTTCTTCGTCTTGGTCCCGCCCTGCAAATTCTTTCAGGTCCATCATCGCCGACAATTTTATCCTCTGCGCGCTGAAACCTCCAGT
AGGTGCGGTTCCTGCGGTTGCCACCTGCGGTCGCCTTAAGTCGCCGAATCAGTTACGGTCTTGATCATATTCGCCCGATCGATCACGGTACGATTCAACT
GATTCCATTTCGACATTTTAGATATATCGCTCTTGGGAACTCGTTGTCCTTTCTTGGACGACCTGGTGACTTCCTCCTTGTCCTTCGCGATCGCGATTGA
ACTTGTCCATAGCAGCCTTGAAATACGA