Description :
From Genome Similarity Track
Location :
Scaffold_80:64097- 65100
Sequence
1003 bases(100 bases per row)
CTGTCGGGCAACATCCTAGGAAGTAGAAACCGGTTGCCACCAAAGGGCAACACGGTTATCCTTGGTCGACTGGAGAGTCGACAGTAGAGGATCGGTACCC
GACTGTGGTTGCACAGCCACAGTCAGAAGACGTCGAGGGAATAAGTCCCCACGTACTTGAGGAAAGGAATCCTCAAGAGTTACATGCTGAGAGAACAGGC
TCTCAGTAACCCGAGGAAGCAAGTTCCCAGAAAGAAACCGAGATATTAAAGGTCTTGGTCAATGCCGGATCAAGCGTAGGTGCTTATACGCTTGATCTGA
TTGTGCCTCCGAAGTTGAATTTGGAGATCCCTCAATTGCCAACGCTAGGACCAAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTG
TGTACTCGTCACGGAGGAAGAGTTCGTGACTGACATTCGGTCGGCAGTAGAATTTGCTGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGACGAAAGT
GTACTCGATGAGAAGACTCTGGTTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATTTGATCGAATTCGAGGACGTGTTCGCT
GAACCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTAATGAAGCCGTGGTCACTGC
CTCATGAACNNNNNNNNNNACATACGTTTTTCTGATCCCACTGTCACAAGGGAAGGAATCGCACCACACAAATTGCAAAGTAATGCGTTGCGCGCGTGTT
CGCTGGGCCCTGATGTAACCTGGAATTCTACACGGCATGGCTGCACTGACGTCTTGTGTCATACCTGGAGTAATAATACAGGAACCCAATGGCCTCCACA
AGAGAAGAGTTTTCTTCGCACCTATCCCATATGGACCAGCTGCGCTGGCGGATACCCCGAGCGCTCATTTATGCGTATCTGATCGGGTAGAATTTTAAAA
ATC