Description :
From Genome Similarity Track
Location :
Scaffold_98:64090- 67797
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18991nucleolar GTP-binding protein 2
Phypa_INRA-310PPTG_18992hypothetical protein
Phypa_INRA-310PPTG_18993nardilysin-like protein

Sequence
3707 bases(100 bases per row)
GATGGTCAGGATGAAGTCCGTGGGCTGAGGCAGACGCTCAGCACGAACGACACCCTTGAGCACAGTCTCAACCTCGTCATCACCCGTGTCATACACGATA
CCGGGGCAATCAATCAGGAAGATGCGGCGCATGAGCGTGATGTACTGCCACACCTTGGTCTCACCCGGGATCGGAGCCACCTTGCACACCTTCTTCTTAC
GCAATGCGTTGATTACCGAACTCTTGCCCACGTTCGGGTAGCCAATGAGACCCACAGAGATCTGCTTCTTCTCCTGGTGCAGCTTTGCGAACTGACGCAG
GAGGTTAATCAGCGCACCCTTGCCGAACGGGTTGCTCATGGACGCGTGGAAAGCAAGCGTAGGCGTCGTCTCGCTGAGCTTTTGCACCCAGCGCTTGGTG
ACCCAGTTGGGCACCAGGTCGCACTTGTTAATGACAAAGATTAGGTGCTTGTGCGAGGCGTTCTTGCGGATGTGCTTCTCCACGTGCTCGCAACGGGTAC
CAGGAACGTTGCGGGCGTCCAGCACTTGGATAACGACGTCCGAGCAGTCCAGCACCTTGTAGAGCTCGCCCCAAATACGCTTGGACTGGCCCTTGTTGAA
CACATCGTGCGAGACCTCTTCCTTGAACTCCTGTTCCACGGTAATGTTGCGATCCGGGCCCTTAGCTTCGTACTTCTCTGCATTCTCCTGCGCTCTGGAG
ACCAGCGACGCGTAGTCCGTGGCTGCAATCTTGGCACGTTTGCGGCTGCGCTTGCCGTTGAAGACCTCGTCGTAGCTCTCGGTCTCCAGAAGTTTCATAC
GCGTCGTCTTCTCGCTCTCTTGTAGCAGACCCATAGGCAGCTTACGCGTACGCAGCACCACCGAGTACGGGTCGGCGGCCTTGAGGGACATTTCGTTGCG
GAACTTGTCCAGCTCCTTCTGTCCCACCACGCGCGTGTTACCGAACCAGCGGCGGTCAGGCTGCACGCGGCCACTAGCGCTGGTGATCTCCTGTCCTCCA
GCCTTGTTCTTCATCATGAGACTACCGCCCACGACCTTGCCGGCCTTGTTGCGGATGGGGCCGCTGTTGCGATACATGTTGAGGCGCTTGATGGTGCTCT
TGTCACGCATGTTGGCCGCCTTCTGCCGCTTGGGGATCTTGCGGTTTGGGTTGTCGGCTGACGCCTTAGTCGTGTTGATACCCTTCGCCATGGCTCTCGT
CTTAGATGCTGCAGAGCGAGGTCAGATACGTGCTCGGCGTGACAGCAATTCCCTAGCGCAAAATGACAGCAAAAGCAGACAACGACCGTTGGAACGATTG
GGCATCAACCGCGCAATTTTCCGCCAATGGAAGACTGAATTTAAACTGGCTTTCTACCAATCATGCATTACTGAGTATTTGATGACAGCGCTGCGTCAGG
CTCCATTTCCGTTATTTACAGCATAGTCTTAACTTTATCTGGCGCTCATATAGAAAGTCGTCTTTGATAACAACACAAAGTATCCTCTTTTTACAATTGC
AGCCCTGTATTCCAGCTGCAAATCGTTCTTCATCAGACGCAGACTGCATCCGTTGTCAGCCATGACAACCATGGCGCTCGCAGCACAGCAGCACCACGAG
CGCGCCGAGATGGCTTCGTATCTGTACGAAAAGCACCTAAATCACCAGGATGGCGTAGCTGGCACGCTGAGCATCCGCCTGGTGGCAGCTCGCAACCTTC
GCGCCGCCGCTTCCATGTTCTGGGTGCGAACATGCAACCCGTACGTGATCTTCCGCGTTGGAAAGCAGAGCGTTCGCAGCGCCACCATTCCAAGTAACGA
TAACCCAACGTGGCGCCGCGAGCTACTCGAGGTGAAGCTGCCCAAGTTGGACCACAAGCGCCACCCTCTGGGCGAGCACTCGGATGTGAGGATGGAGCTG
ATCGTTGACGCAATGAACGAAGACTCGCTCACCGGTAAGGCCACAGAGGCCGTGGGTATGGCCAATGGGTCTGTAATCGGCACAGCCGCCGTGGACTTTA
CGCCGCTTATTGAGGGCAAGGAAGACGTCATGGACCAGTGGATCCCACTCAGTGGTGCGCTTCCCATGGCTGCCGCTACTGGAGGAGCGACAGCCGTCAA
GAAGCAGCAGGCTGAAGCAGAACTGAGCTTGGGTGAGGTTCGTATCGTGCTGCAGTACGAGCCGCACGGCATGGAGCCGCGTGTGGGTGACGTGGTGAAG
TTCGAAGGTTTAGGCTCCTACCCGTCAGCGGTGCTCGGTCCCGTGGAAGAATTAGAGCTACATGTGAAGAAGACGAGCGGCAGTTATTTGCTGTGCAGCT
ACACGACTCAGTCTGGCTATGAAGCTACGTTACGCGTGCATCGCAACAACGTCTTCGTTGCACATCGCGGCAGCTTTTTCGACCGCTTCTACGAGTCGTT
CGTCGTCGAGCCACTGGAGTTCGTAGGTAGCACACCCATCGGCCAGTCTGCCAAGGAAGTGCTGCGTCCGTATATGAATGTGGCTCGTGCATTCAGCGGC
CCAGCCCTGGTGGCGACGAAAGCTACACTCATGACGACGTACCGTGCGTCTACGGCAGCTATCGGTGCGGTGGTGGCATCTCTCGACGAGTAGAACCCGT
GACATATGTAGCTCAGAGAGGCAAGAAATAGGCAAGGCACAGTAATGAGTCAATGATAAGTATGAATGAGCCTGCATTTGATCAAGCAAATATGTACGAT
GGCAATTCTACTGACAAATGCGATTCTATTGAACAATTGATTGATTTCGGTAGTCGCAGGTGATTGGCGAATACTGAAACATATGTAGTCACAGACTTGA
AGGCAGCATCAAGGACGTTGACAAGGTTTTGAGACAATGCTGGGTGCATTTGTGGAGAGCTGTAGCTCTCCCCGGCTTATTCACATCGCAATCGAACAGG
GGGCCGCGTTGAGGAAGTTGCTGAGATGACGTCGCCGCTGTCTTCTCGTATGAGTCTGGACAGCTTCCGGTCGCCCGCAGACAAGAAGAGCTACCGTCTC
ATCACTCTGTCCAATGGACTGGAGGTTCTGCTCGTCCAGAGCGATGCTAGTCCAGTCAATCGATCAACATTCGACTGTAATGACGATGGCAATGATCTGG
ACAGTCTCAGCTCGACGGATGACACGGGCTTTGACGAAGAAGGAGACGAGATCAACGATCGAGCTCCAACATTGGCCGCAGCGTGTCTGACAGTAGATGT
GGGCAGTCTGGCCGATCCGGAAGACTTGCCAGGTCTAGCACACTATTTTGAGCACATGATCTTCATGGGTAGTGAGAAGTATCCAGCTGAGGACGCATTT
GAAAGCTTTTTAAGTGCACACGGAGGGTCCAGCAACGGAGCGACAGAGTGCGAGTCTACGAGGTTCGTGTTTGATGTGGATGCTGCTTACTTGGCACCAG
CACTTGATATTTTCGCGAATCTTTTTGTGGCCCCGATATTACGACGTGAAGCGATGGAACGCGAGCTGAAAGCAGTTGAGTCCGAGTTTCAGCGGATGAG
GAACAATAATTCTGTCCGTTTGCAGCAAGTTATGTGCGAGACAAGTGTTCCAGAGCACCCATACTCGCGCTGCTTTACGTGGGGCAATGTGGAAAGTTTG
AAACACAATCCAGAACGCGATGGAATCAACGTTCGTGAACAAATGCTTCAGTTATTCAATAAGTTCTACGTGGCTCCAGCAATGAAGCTATGTGTGTATG
GGTGTGA