Description :
From Genome Similarity Track
Location :
Scaffold_30:640759- 642601
Transcript NameFunction/comments
Aphas_H257_10185catalase putative

Sequence
1842 bases(100 bases per row)
CGATCTGCCTCGTGCAAGACTGCCGCAACCAAGTCTTTGCCCGCAACCTGTGCGTGCGCCACGGCGGCAAGAAGACATGCGTCTACGATGGCTGTCACGA
AAACGTTCGGTTAGGGGACCTCTGCGGGAAGCATGGGGCGGGCTCCACACGCAAGATGTGCATCGAAGACGGCTGCAACAAGTTTGCCCAAACCAAACAA
CGCTGCTCGGCTCACGGGGGGGGGCAGCGATGCAAACTCCCAGGCTGCACCACCCACGCTCGACGAGGCGGCTTTTGCACCCGACATACTAACCAAGTTA
CTCGCAGCACCATCCTTGTCGAAGACACCGTCAAGCGCGTTCCGCTTTCCAAGATGAGCTTGCTCGCGATTCTCAACCACGACTCGTCTGAACTGTAAAA
TAATCTCATAAAGTAGTACTATTTAAATTGATTACCTTGCCTGCGTTGTCTTGCCAGCGCGAACTGCGTAGGACATAAATGTCAGCCGCGGCGATATAAA
CATACTCGTATGGATGGATACACGACCGATTCATAGTACAAAATACTGTAGTACTACTACGTAGTATACTTTTGGTGACATTTTTTGCGTTGATCATGTC
GCTGGTGGAGAGACAATGAATTTACAACATCATTTGAAGAATCCACAATGAGGGAATCCAGAATCTACAACTTCAAGGCATTCACATGTCGCATACGTTA
CATTGCTTCTTACCGAAATAATTCCCTCATTAACTGTAAAACAGTTCCGCTGTTGTATTGACCACTGTTTCAATGAGGGAATTATTACATCCGGATACAC
GTTTTCGCCAGTAGCCGTGTAACCTGGGACTCCGTCCTACCCCCGGTGAGTACATACGATGCTAAATCTCCGGGGTTAACTGCATCGCTAGTGGTTAGCT
ATCGCTAACCACTGAGATGCACTTAACCCTAGTAAGAGGTGACGTGGTCTGAGCATACAAAGTTCCATATAAACCTCATTGAAAGAGTATTTCGGATCAA
AACAACAGTGGTACTAATTTAATGAGGGAATTGTACCTTCTTACCGTTTTCAGCTTGGTACGCTTTTGCCTGTACCCTTGTAACCCCGGAACCCCTTGTG
TTTACATATAATGCGTGCCCCTAAACCACTTGTGTTTACATATAATGTCTGTTCCCGGGGTTATGTTGCATCGCCGGTGCTTAGCTAACGCTATCCACTG
TGAATGCACGTAGCCCCTAGAGTACATGTGTACAGTACGTAAGTGTTTGACATACCGATCAAACTGATCCTGATGCACCAAAGTTTACAAATTTGAAGTA
CAGCATTTGTATACATTGGTTGGAGTTGTAGATTCTTGCCAGAAGTTGTAGATTCTTGACAGAAATTGTAGATTCTTGACAGAAGTTGTAAAGTCTAAAA
TGGCGCTTGTATTTTCTATTTATCTCCTTCGAGTACCGGTACCTACAGTAAGCAAAACGGCACACCAAGACAGGAAACTATGGGAAAACGTTCAAGAAAT
CTGGATACCGTTCAGCCAAGACTGAAACCCGTTCAAGCAAATTTTCTTCCAGTAACCCTGTAACCCCGAGACTTCGTCCTACCCCCGTGTGCACATACTT
CGAAGTATAATGCTAAATCCCCACCAGTGGTTAGCTATCGCTAACCACGGAGATACATATGTACGCCTAACTCCTACTATGAGGTGAGGTGGCCAGAGTA
CAAAAATTATGCCTAATTTAACTAGAGTTTATTAGTTTGAACGGTTTTCAGTCTTGGCTGAACGGTATTCAGATTTGTTGAACGTTTTTCAGGGTTTGTC
CACCAAGACATGGCGGCGCGATCGCTCGTGACTCTAGAGAAA