Description :
From Genome Similarity Track
Location :
contig_5:640535- 641602
Transcript NameFunction/comments
g1764.t1OWZ08005.1 hypothetical protein PHMEG_00019519 [Phytophthora megakarya

Sequence
1067 bases(100 bases per row)
GAAGAAGGAGCGTGAGCAAAAGCGGCGAGAAGAACTATTTGCAAAGGAGCGTACGCGAAAGCAACGGGAAGCTGATGAACAGCGGCGACAACAAGAGATT
GAAAGAGCGGAGCAACACCGCTTGGATCTCGAGCTGGCTCGCAAACGAGCTGAAGAGCAGCAGAAAGAGATAATGCGCCGTGAGCAGCGTGTTAAACAAG
AAGAAGCCCGCAGACAGCGCGATGCCAGCTCAGTGAGAAAGAGCGTCTACGTCACCAGGAAGAGGCGCGAATGCAGAATGAGCTGTACCAGCTTGCCCAA
GAGCGAGAGGCAACACGGAAGCTCCGTGAAATGCAGGCTCGCGAAGAGAAGCTTACGGAGGAGCGAGAGCGCCATAGGAAAGCTAAGGCTCGGGAGCTGG
AAGAAAACAGGCGCGCAATACCGAACGCATTGCACTTGTGCTGCAAGAAAAGGACCTGCAGCGCAGGGCTCAACTCGAAGAAGCGGCCCGTAAGCATCAG
CAAAGCGAGGAACGCCGCCAAGCCTTTGAGGAGGAGCGAAGAGCGAAGGAGGAAGAAGTTCGACTTCAAGCACAACGCAAAAAGGAGGCAATCGAAGGTG
TTCAAATCCAGTTAGCGTCAAATGAGGCGCAGCGGCGTGAGCGGCTAAGAGAGCAAGAGCGTCAAGCCCAGCTGCGGTTGATGCAACGAGAACGGGAGAA
ACAGCAGCAACTTGAGGCTCAACAGCGCGAGGAAAGGCGACTGGAGCGTGAGCGGCGTCGGGCCTATGAACGCATGGAGTCTCAACTACAAAAGAAGCAA
TCAGCCATTCTGCGCAAGACGGAGGAGAAAGCGGCGGTAGCGCAAATGATGCAGAAGCAGAAGTATGCATCTGTGCGTGCTCGACTGCTAGACGCAAAGC
TTCGGGAGGAAGAAATCCAGACGGCGTTGATGCGCAAGAGCAAGCAAGACGAGTATCGTACAAACCTGTTACTCTCTCGTATTGAGAACGATAATGAGCG
TACGCAGCACCTCAAGCAGCACCGCACCGACCTTATTCGTCGACGGCAGCAGATCAAGCAAACTGCC