Description :
From Genome Similarity Track
Location :
contig_5:640489- 641556
Transcript NameFunction/comments
g1641.t1hypothetical protein

Sequence
1067 bases(100 bases per row)
CTGGAGCGGATCCAGCAGCGGCAAGCCCTTGAAATGCAGCAGATGCTGAATTTTGAACTGAAGATGAGCGATCTCCACCAGGAGCGCGAGAAGAAGGAGC
GTGAGCAAAAGCGGCGAGAAGAACTATTTGCAAAGGAGCGTACGCGAAAGCAACGGGAAGCTGATGAACAGCGGCGACAACAAGAGATTGAAAGAGCGGA
GCAACACCGCTTGGATCTCGAGCTGGCTCGCAAACGAGCTGAAGAGCAGCAGAAAGAGATAATGCGCCGTGAGCAGCGTGTTAAACAAGAAGAAGCCCGC
AGACAGCGCGATGCCAGCTCAGTGAGAAAGAGCGTCTACGTCACCAGGAAGAGGCGCGAATGCAGAATGAGCTGTACCAGCTTGCCCAAGAGCGAGAGGC
AACACGGAAGCTCCGTGAAATGCAGGCTCGCGAAGAGAAGCTTACGGAGGAGCGAGAGCGCCATAGGAAAGCTAAGGCTCGGGAGCTGGAAGAAAACAGG
CGCGCAATACCGAACGCATTGCACTTGTGCTGCAAGAAAAGGACCTGCAGCGCAGGGCTCAACTCGAAGAAGCGGCCCGTAAGCATCAGCAAAGCGAGGA
ACGCCGCCAAGCCTTTGAGGAGGAGCGAAGAGCGAAGGAGGAAGAAGTTCGACTTCAAGCACAACGCAAAAAGGAGGCAATCGAAGGTGTTCAAATCCAG
TTAGCGTCAAATGAGGCGCAGCGGCGTGAGCGGCTAAGAGAGCAAGAGCGTCAAGCCCAGCTGCGGTTGATGCAACGAGAACGGGAGAAACAGCAGCAAC
TTGAGGCTCAACAGCGCGAGGAAAGGCGACTGGAGCGTGAGCGGCGTCGGGCCTATGAACGCATGGAGTCTCAACTACAAAAGAAGCAATCAGCCATTCT
GCGCAAGACGGAGGAGAAAGCGGCGGTAGCGCAAATGATGCAGAAGCAGAAGTATGCATCTGTGCGTGCTCGACTGCTAGACGCAAAGCTTCGGGAGGAA
GAAATCCAGACGGCGTTGATGCGCAAGAGCAAGCAAGACGAGTATCGTACAAACCTGTTACTCTCTC