Description :
From Genome Similarity Track
Location :
Scaffold_5:64019- 66122
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_01848Hypothetical protein
Sappa_CBS223.65SPRG_01849Hypothetical protein

Sequence
2103 bases(100 bases per row)
GTTCGTTAGAGGCGAGCCTTTAGCGACAATCGCGTCCTTGTACTTCTGGAGGCGCTTGGCGACGAGTGTCTGCTGGAAGAAGAGGACGCCGGCCCACTTG
TCGTAGAGAGCATCGAGCACATAGTTGTGTATGCGGCACAGAGACTGACGCGACCGACCGAACACGATCATCATATCGCAGTACCGCCGAGGGTAGGCCA
AGCGGTTGAGAGCAACGCAAAGGGCTTCGACAGCGAGGCATCGATCCCGACCCTGGGTGATAACGACGGCCGGGAGTTGAAGGGCATGTGAGAGGCGCGT
CAAAGAAGCCACGTCAAAGCGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAATGCAGGATTGCATCGGCGTCGTTCATCGAGTCGAGGTCGAGGCGCGTGTCCGGAACCAACGGCCGCTCAATTAC
CGAGAGGAGCAGCTCGAGGAACTGACGGCGGCGGTGACGAGACATCCGGCGACTGCGGCGAAGCAGCACCGCAAGCTCGCGGGACGACAACATCGTTTAT
GATTAGGTTAGGCTATCGCAGCAGTAGCACAAGACCAGACGAGGATGGAATTCTTCTGAATTTTTTGCGAAATCAAGGTTGATGTAGCTCCCGTCTTCGT
CTGCATTCGAATGCCGACGGAGACAGGATGTCCTGTGCGAAATCACAATTTTTACTTTTTGCGTCCCGTCTCCCTCCACATAAAATAAAACGCAGATGGA
AACGGGAAGTCAGTTGCGAAATCTCTCTATTATTACACCACGCTAGATCCCATTACAGAAGTATTTGCGCCGCTGTGATTTACTACAAGGTTCTTGCCGC
CATGCGTGTTCGTCTTGTCAGTATACTAGTACTCCATGAGACTCATGGGATCCTCGCTCTCGCGCGGTGATTCGATTGGCGATGTATCTGGAATTGCGGG
CCGTGGCCTCGAGCACATCGCCTTGTCAGTCCGATCCTCAGCCCGCTCGTCAGCGGCGGCCTCTCTCTCGTCATCAGTTGCCTCCAAGCCAACGATCAAC
GCGCCGCGATCTGAAGCAGCGACTGACCACGCCACTGGTTGGTGCGCATCAAAACCAGAAACCGCCACTTCGCCTTGACGTCGATGGGTGGCACCAAGGC
GGCGACGTCCATGTCGACAACATACCTGCAGGTCATCCAGAGCCTCGAAAGCACGGTCAAGATTGCTGGCAAGTGCGCTCTAACGGGCGAGCTATCTGAT
ATTGGCACGCCCAAGCTTGGCGTCGACAGTTCGCAAGGCCACAAGCCGTCGCCGGATCTGGTGCCGGTCAAGCAGCCAGCTTCGGTCATCACCAGCTTTG
GCGCCGCGCCGCTGGTCGTGCCCAAGGAGCACATCTACTTTGTCCAAGGCGAGCACGCGTGGGCGCGCTACCTTGACGGCTGGACGCTGCACATCGTCAC
GAGCGTCCTCAAGCCTACGTGTCGACCCCCCGTGCTGCATCTATCGCCCGTGCTCACGCCGTCGCATGTGCCCCGGGGTACGTTCGGGACGTCGCCGTGC
GCCCGGCGCATCACCATTACGGGCCAGGACGACATTGCGTGGACGCATAAAAGTATGACCATGAGCTTCGCCGTGTGGTACAACGACTGCAGCCTCGCTG
TGGCGCCGATCACAGCGCCCGGCAACCGCGCCTACCTCGTGTACAACTTGGTGACGAGCGACGGCGAGCCGCATCGGAGAGGTCCGGCATCCACGTCTTC
CGCCGCCAGCGAGCTCGCGGCCCTCGCTGCCCAGCCCCACCAGCTTGACACCACGTATGCGTCATGACTCTGCAACAAGACCACCGATCTGCGGTTCGAG
GCGCTTCAAGGTCGCGATGCTGCTCTCGTCGCTGCGGGGTCATTTGATGTCGCGCTCGTTCGAGCGTCGCGGCAGCAGCTCACGAGCACTGAGATGCACA
CGCCCAAATGCAACAAGGCGCGGCAAGAAGCCCTCGACATTACGACATGGCGTCAACCGTACCAACGCGTGTGCAGCTGCCGAAGGAAGAGCGCACACCG
TTG