Description :
From Genome Similarity Track
Location :
Scaffold_227:64011- 68858
Transcript NameFunction/comments
Hyaar_Emoy2812927protein kinase
Hyaar_Emoy2812928protein kinase

Sequence
4847 bases(100 bases per row)
TCTTCTCTCTCCTCTTCCTCTTCCTCCATGCAGAGTCGATCCTTGACCTCGCACTGCAGCAGCAGCCCCCACTTGCACGGCAACACCAAAGAAATCGCAG
ATCGCTACGAGCCACAGACGTCCCTGCACTCGGCCCTCTTTGGCGAGATCCTCCTGTGTCGCGACCGCCTCACGCTCGACCGCGTCATCGTCAAGACCGT
GGACCTGCAGCTGGCACGACGGCAGACGTCGCGCGCGCAGGAGCTCGTGCAGGAAAACGTGCAGCTCGAAGTTGAAGGGCTCAACCGCGTGCGCGCGCTC
GGCGGCCACCCGAACGTCATCAAGCTCCACCGGTGCTTTGTGGCGAAGGGGGTGCTGCACCTGGTGCTTGACTACTGCGAGGGCGGCGACCTGTTGGACG
CCTGTGTACAGCGACGCAGCCCAGCAGACGACCGCAAGAAGACAAAGAGCTACAGCAGAAGCAGTTGCAGAAGCAGTTGCAAGAGTAGCAATGATAATAG
CAATAGCAATAGTAGCAGTAGCAACAGTTGTACTGGTTGTGGTTGCAATGATGGCAGTTGCGGTCCGAGAGAAGACGCCAGCGCAGCCGTCGCAAGAGCG
ACACCAGGGACGGATAACGAGCCGAGTCCCGAAGACGACGACGAGGAAGCCACCGAGGACGACGGACCGCTTCTAACCGGCGTGGACGGCTCCAAGCGTC
TGCAGGAGACGGTCGCGCACAAGTACCTCGTGGACGTGCTCTCGGGGCTGCGCTTCCTCCACTCGCACGGCATTGCCCACCGAGACGTGAGTCTCGAGAA
CATTCTGCTGCGCAACGGGTGCGCCGTGCTCGCCGATTTTGGGCTGTGCGTGCCGGAGCTGTCGTCCGTGTCAACGTCGTCCTTGTCACGGGCGTCCTGG
AACCATCGGACGACAGCAGGCGCGTTTTGCTGTGACGAGACGGTGGGCAAGGACTACTACATGGCGCCCGAGATCGTGGCCCGCGAGCGCTACGACCCTC
GACGGGCCGACATTTGGGCCACGGGCATCGCGTTCTTCATTTTGCTCACGTCGTCGCCGCCGTTCGAGCGTGCGGACCCTTTGGACCCGGGCTTTCGGTA
CGTGGCGAAATGCGGCATCCAGGCCGTGTTTACGGCGTGGGGACTCGACCAGGACGTGTCGGAGGCCATGCAGGATCTGCTGGCGCGGATGTTGTGCGTG
GACCCGGAGGAGCGCATTACGATGGCCGAGATCTGGCAACACCCAATGCTACGGAGACAGTGGAGCAGCATGTTGTCAACCAATGGCTGCGATTAAACGG
CACATTGGATGGATGGTGCACGAGTCATTGGCGACCGCTTGTCGATTGTGCGTGGACGGGAGCAAGGGTCGAGCTCAATTGAGCTAAGAGGGATGAGAGG
TCAATCGATAGATTGTCCGTCCTATTACTGCTGCTACTATTTTGGAGGGATGGCAGGGTGGCCACCGGATGTCCGGGATGGACGAGGAAGTGGCATGTGA
TGAAGTTATAGTTCAGAGATACAAAGGACCCCGGCGGTAGACAAGGACGTTTGGTACTGTGAAGAGGCATATCGAGTTGATCGATGGTCTGAGTGAATGA
ATGGGACCATCGCTCTGGCACACGGCATGGTCGACTACTACATAATTAAAACTCGGACAAGGTTAAACGTACCAGTCGTGAGTGGGTCATTGTACCGGTG
ATTTGTTTTGACCAACCAAAAAACGATTTGCTGATCATGATTTGTGATACCAAATCTAATTATGACGATACCAGCCTAATTTTGAGATATCTAACCCTAC
TTCAAATTTTAATCGATTTTGCTGTAATGGCGATGGTGGAAGGCAATGAGCTACAACGCTAAGGTTCAGATAGCACAGAGATTAAGCATACGTCGACATG
ATCAAAATTAAGTAGATATTTCTACGCTTAATCCTCGTTAGCGGCACACTACACTTGTTTCATGCCTACATATACATGCTATATTACTATCATTTCTCTT
TTAAGCAGAAATGGCTATAATAGCGTCACGGTGAATGCATTCCTAGTTGCACTACTAAGATTTCTCTTCATAGTGCATACAACACGTTTCGGCCAACAAC
AAATTCGTCAGAAAAACGTCACTCACGATGACCACGACAACAACAACGATGCCAAACCAGTCAACGCAGCCAGATTCAAGGCTCCCAAGGTTGAGCTATG
CCAAATAACAGACATTTAGACGATTCTTCAATGTCGGTAGACTCTCACATCCTATTTTCTGAATAGAAAGCAAAACGACACACATAAATGTGTTGGGCAT
GCATATGTATGCCTTAAACATGTGCTGTGTACTCTACAAGAATACTACTATATCAACAGAGCCACAATATATAGGATATTATCGAGTGTGTCCAGTCGAT
ATTCTCTCTATCTCCTCCATTACCTGGGCCTTCGTAGCTTGCCACCCTCCCAGCAATCGCCATTAAAGCAAATACGATTAAAAATTCGAAGTAGGGTGGG
TATCTCAAAATTAGGCTGGTATCGTCATAATTAAATTTGGTATCACAAATTACGATAAGCAAATCGTTTTTTGATTGGTCAAAACAAATCGCCGGTGCAA
TGACCCACTCGCGACCAGTACGTTTAACCTTTCCTTAAAACTCAAGTTGCCAAAATAGCTGCGACATGTGTGTGTGTGGGGCATCTCTGTTCGCTGCGGA
CACGATGGAACTAGTGAAGGCAACAAAGAAGACGAGGACCGAGTGGCTCACACAGACTGTACGTCTTGAGAAAAAGTGGGGCAACGACCGGTGACTAACC
ACCATCCTGCGGTAGTGTACCTTGTCTTCTTCCAATAGCTTGCAGTCGTAACCTTTGGTCGTCCTTGTGCTTGTGCTGTCCATACATTCGCCTCTCGTTT
TCTCGTGCTTTGGTATTGGTACAGGAGCTTCTCCAAGAGCGATAGTCTCGGGCAGCGCTTGGTGGAAGAAGCCATGAAGTCGTAGGACGGCAACAGATTG
GTGGCTGTTCGTTTGTCGTCAGAGCTGCTCACGTCTCGTTTCCGTCTGCTTTTGCTTGCTCAGTCACAATACGTTGCTCATGGCCGTGGATCCGATCGCC
GCAAGTGTTGTCGGCTACATTCTGTTCCGGCGCAACGGTGTACGTAGGTTTTTGCACGAAAGCGCGACTCAATTCCAAGGTGTGTGGCCTCATGCGACGT
TCGTGGTGCTGTTTACAGGCCGAAGGCCACATTGACCGCATCGCTGTGGATGAGCACCAAAGACGGAAAGGTTTAGCTCGTTCCTTGCTGCAGTCTGCTA
TTGCGGCCCTGCGCACGAACAGGTTCGTCAAGCAGAAAACGGAGAAATGACAAGCAGCCGTCTACTTGTTGCATCAGTTGTAACCTGCTCACTATCTGCT
TCCTATGCAGGGCAATGACGCTTGTGCTGGAGGTGGATACGACGAATAAAGGGGCTATCGCGCTGTATGAGTCACAAGGGTTCAAGCGCACTACTGTCCG
CATCGACTACTATAAGTCTGGTTGCGATGCGTTGCTCATGGAGCTGCGTTTGTAGCGATAGTAAAGGCTGACGACTTCGAGTGAATACTCGATATCGCTG
CAGCATTTGAACGACGTAGCAGCGGTGAGAAACAGTAGAACTCTTATCATTACCTAGTGATATTCATAAACTAAAGGTCAAGTTAGGCTCGTGTCTATCA
CGATCTTACGATCGACTCAACTCCTTCATCGCAGCGGCAGCCTCATAACCTGAAATGCCACAAAATGAAGAACGCGATGCCCGTGGCCCAAATGTCGGCC
CGTCGAGGGTCGTAGCGCTCGCGGGCCACGATCTCGGGCGCCATGTAGTAGTCCTTGCCCACCGTCTCGTCACAGCAAAACGCGCCTGCTGTCGTCCGAT
GGTTCCAGGACGCCCGTGACAAGGACGACGTTGACACGGACGACAGCTCCGGCACGCACAGCCCAAAGTCGGCGAGCACGGCGCACCCGTTGCGCAGCAG
AATGTTCTCGAGACTCACGTCTCGGTGGGCAATGCCGTGCGAGTGGAGGAAGCGCAGCCCCGAGAGCACGTCCACGAGGTACTTGTGCGCGACCGTCTCC
TGCAGACGCTTGGAGCCGTCCACGCCGGTTAGAAGCGGTCCGTCGTCCTCGGTGGCTTCCTCGTCGTCGTCTTCGGGACTCGGCTCGTTATCCGTCCCTG
GTGTCGCTCTTGCGACGGCTGCGCTGGCGTCTTCTCTCGGACCGCAACTGCCATCATTGCAACCACAACCAGTACAACTGTTGCTACTGCTACTATTGCT
ATTGCTATTATCATTGCTACTCTTGCAACTGCTTCTGCAACTGCTTCTGCTGTAGCTCTTTGTCTTCTTGCGGTCGTCTGCTGGGCTGCGTCGCTGTACA
CAGGCGTCCAACAGGTCGCCGCCCTCGCAGTAGTCAAGCACCAGGTGCAGCACCCCCTTCGCCACAAAGCACCGGTGGAGCTTGATGACGTTCGGGTGGC
CGCCGAGCGCGCGCACGCGGTTGAGCCCTTCAACTTCGAGCTGCACGTTTTCCTGCACGAGCTCCTGCGCGCGCGACGTCTGCCGTCGTGCCAGCTGCAG
GTCCACGGTCTTGACGATGACGCGGTCGAGCGTGAGGCGGTCGCGACACAGGAGGATCTCGCCAAAGAGCGCCGAGTGCAGGGACGTCTGTGGCTCGTAG
CGATCTGCGATTTCTTTGGTGTTGCCGTGCAAGTGGGGGCTGCTGCTGCAGTGCGAGGTCAAGGATCGACTCTGCATGGAGGAAGAGGAAGAGGAGAGAG
AAGAGGGAGTTTGGGTGGAGACCGTCGTGGCGATTGCGAGACAATTA