Description :
From Genome Similarity Track
Location :
Scaffold_431:6401- 9850
Sequence
3449 bases(100 bases per row)
CCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGATTCAGCGACG
CCAATTCCGACTTGCGAGTTTCAGCCAAGATGACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTAC
AACGTGAAGATATTTAACTGATCGAAGCTTGGCCGCGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCTAGGTTTCCTTCCTGCATGCGATCACCCCTAAT
GATTGTTGAAACGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATTCCTGTATACTCTG
CCTCATTCACCATGGTGGAAGCGTTTGCAGCAATCACTATCGTCCACTCAGGAAGACTCCACAGCACCCATGAACAACTCCCGTCGCCACCGTACTTCTC
TGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGGTACAGCAACGCGGAGTTCATTCGAATAGTCGGGGAACCCT
TGTTTAGGGGGGGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGGAGCTGTGCGAAGGCGACATCTTTCTCCTTCA
CGCGCTGCACCTTCAAATGCCACTGCGAAAGCAGTACGGCAAACTGGACCGCGCGTCCAAAGAGAGACTTCGACTTGTGCACCCACTCTAACGTCGAGAA
TCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTC
ATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAA
AGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCGAAGGAACGACGTGCCACAGA
AAGGTCACTTTCAACGTCAAAGTCCCCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCT
CCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTT
TATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTAAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGT
CGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCG
TTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAAC
CCTCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCATCTCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCA
GAGTGCGTTGTCAATCATACGCTGATAGATCATCGGTGCGTTCTTTAATCCAAAGGGCATGCGCAACCACTCGAAGTGTCCGAGTGCGCAGACAAACACC
GACACTTTACGTGCTCGCAGTGTCATCATGACCGCCCAGAAGCCGCTTGCAGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGT
CGTCGACTAGCGGCATTGCATACTCCATGATTGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCAC
AATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATTGCAGC
GGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAA
TCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTCGACAGCTCAGGATCAGCAACATTAGGCGCAGTGTAGTCAATTGT
CGTGTTGATCTCTTCGGTCAGATCCGGCAGGAATGCCAGCTCCTTCGCGTAGTCGTCCAAGCCAATGTTGTTAGCTGGGTGTTCGTAGAAATCATTTCTC
GTATCCTCCGTTGCTTCATTTCCCTCGGTTGTTAACACTCGAGCAACCGAGATGTATGTTCCGTCCAACGCCGCTACGGATTCTTCCCTTGACTCAACAT
TGGCATCCGTTTTGATTTCAACAGTCGGTACTTGGTCCATCTCCTTCCCATCCTGGTTTCCCATCTCTGGGCCACCTGCCGAGTCGTCGTTCGCAATATT
GAATGCGTGGGCCGTCGACATATTGGGTTGTTGACTTTTGTTCCGCTCCTCGTTCTGCCGCTGTCTTGACATTTCGGAATTCGCACCAATCTTGCAATGA
ATACTCAGTGCCGTACTCAACACCTTCTGCGCGATGCCTGTATCCTCTGGATCAACCACCGGTGGCTCGTTCGCAGATTTGGCGACACACAAGGCCGGGA
CAGCTTCGTCAAAACGGGTGACTCCATTCAATCCAGTGCCGTGACTTGTCGCTTCCGTGGTCACCCCTGACTGGACACTAACACTCGTTGGCGTATGTAC
CACGTTTACCGGCTTCAGTAGTTCGTGTGTACGCACTACCGAGGCTTCGTTCGCGTTATTGCCTCCGCCATGGGTTGTCGTGTAAGTGTTCAAAGGTTCT
GCGGAAGGCTGACCGTCGGCCAAATCCCCGGCTGTCACCCCAGACGCCAGACAGGCTTCCACTCGTTCACGTTCTTCCAGGATCAGTGCCCAGCGCTCTG
CACATGTCAGACGATCACTAGAATCCACTAGCGAGTCTTCTAGAGGTCGTGCTAGCACCCCACCGGGTTCTGGGTAGTATGATCGATCAACTGCTGAAGG
CTGAGTTGCAAGCCATTGTTCGTAGATTTCGCATTCACGCTGAAAGAGCTCGCGGTCTCTACAACCTTCGTAGGCCAACACTTGCCAGTCTTGGTACTTC
TTGGACTCCAGACGCACATAGCCGTCACCTCGTGGCAAATCCCCATCTGGAATCCACATCGCGATCGAGTCGTGTGCTGGTAGGTACACAGTTCGATCAG
ACACGTTGGTCAATCGAATGCTCTGAGGCCGTCCACGTCGAAACCTCGT