Description :
From Genome Similarity Track
Location :
Scaffold_3806:640- 2119
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3806-fgenesh-gene-0.0Propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
1479 bases(100 bases per row)
TGAGCTCACCAAACGTCGTGGCAAAGTCGCTGCTGCGCGAGGCCGCGCCCGTCAACTGACTGCTGGCCTGGGCCTTTTGCGAGTGCATGATGGCGCCCAC
GAGCGTGAGCTCCGTGAGCTCCTTGGGCGTGAGCTGCACGCCCGAGAAGCCCTCGGGGTACTCTTCCTCGATAAACTTGGTCGTGATCTTGCCGCTCACG
AACCGCGGGTGGCGGTACACGTCCTGGAGAAACGACAGGTTGTTGCCCGGGCCACGGATCACGTAGTTGTCGAGCGCGACTTTCATGCGCTGCAGCGCCT
CGTCGCGGTCCTTGCCGTGCGTGATGAGCTTGGAGATCATGGGGTCGTAGAACATGGAAATGTCGCTGCCCTCGGTCACGCCCGAGTCGACGCGCACGCC
CGGCAAGTGCACAGGCTCCTGGTACTGCAGCAGTCGCCCAATGGACGGCAAGAAGCCACGCAGCGGGTCCTCGGCGTACACGCGGCTCTCCATGGCCCAG
CCATTGATCTTGACCGGTCCACTCGTGAGCCGCTCGGGCAGCGTGTGGCCCGCCGCGACGCGAATCATTTGCTCCACGAGATCCACGCCCGAAATCAACT
CCGTGACCGGGTGCTCCACTTGGAGCCGCGTGTTCATTTCCAAAAAGTAAAAGTTCTTGTTCTTGTCGCAGAGAAACTCGACCGTGCCGGCCGACTTGTA
GTTGACCTTGCGCGCAAGCATGCAGGCCTGCTCGCCCATGGCACGACGCGTCTCGGGATCCAGCAGCACGCTGGGCGCCTCTTCAATGACCTTTTGGTTG
CGGCGCTGGATCGAACACTCGCGCTCAGGCAGCGCCACGACATTGCCGTGGGAATCAGCGATCAACTGGATCTCAATGTGGCGCGGGTCCTCGATAAACT
TCTCAATGAACATGCGGTCGTCGCCAAAGCTGCTCGCGGCTTCTTCCTTGGAGAGACGGAAGCCGATCTCGACTTCGTCGTCATTGTACGCCACGCGCAT
GCCCTTGCCGCCGCCGCCGGCGCTCGCCTTGATCATCACGGGGTACCCAATCTCGCGCGCCACCTTGACGGCGTCGGCGGCCGTGTCGATCACGCCGAGA
AAGCCCGGGATCGTGTTCACGCGCGCCTCCTTGGCAATGAGCTTGGACTCGATCTTGTCGCCCATGGCCTGGATGGCCTCGTGGCCCGGGCCAATGAACG
CCACGCCGATCTCTTCCAGCGCCTCGCAAAAGTCCTTGTTCTCCGAGAGGAAGCCGTACCCGGGGTGCACGGCCTGCGCGCCCGTGGCCTTGACGGCCTC
GATAATGGTCGGGATGCTCAAGTAGCTCTGCGCCGACGCCGCGGGGCCGACGCAAATAGCCTCGTCGGCCATGCGCACGGCGACCGAGTTGACGTCCGGC
TCGGAATAGACCTGCACCGTCTTGATGCCGAGGCGGCGGCACGTGCGGATCACGCGCACGGCGATCTCGCCGCGGTTGG