Description :
From Genome Similarity Track
Location :
Scaffold_1444:64- 4407
Sequence
4343 bases(100 bases per row)
CGCTAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAA
CAAGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGG
ATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACGTATCGTTGTACGCTCTTGAATAGTCCTC
TCCAGTGGAAACAATCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAA
GGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGGTCCTCGTTGACTCTCTTTGTAGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTA
ATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTTGTCCCAAGATCCACGCTTCCTCG
TTTTGTGCTTTGAGGATCCGCTTAATGCGGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGATGCTGGATCCAGCCCTTCCTCTGGACCTAGTGACG
GCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGACGCTCTGCCTCTCTCTCCACTT
CGACACCACATCGATTCCGTAAAGCGGCACTGACCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAAATCGTGATTCATCCAACCACG
CAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCTCCACAA
ATCACCAACCTTTTCGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGG
ATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCCCCTCCGCGTCGTACACGAGCGGATCCATCGAGACTCAGGAC
GTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTA
GCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAGCACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCC
ACTGTCCCAAACGTCCTTGTAACCCGGCTGACTTGAACAGCCAGGCTAACGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTA
ATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAATTCATTCGGCTTCAGTGTACGGCTGACGAAGGTGACTGGA
TGACAGATCCCCTCATGTTCTTGAACTAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGA
GGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTC
TATCCAGCCTGGATCCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCC
GGCATCTAACTGGGCCAGAGCTTGTTGGAATCTTCATCCGGACAGCCTGGAGTGGTCATCGCGGCAAACTCTACCTTCTCTCCAAATCGTACAATACCGC
GGCAAACAGGGCGTAATCCTCGATGAACCCGACTGTAGTAGTTCAACCTGCCCAAGAAAGATTTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGG
CTAATGAAGACAGGTCCTTAGGATTCGCCTCCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCCAATAGCTCTTTACC
ACACTAATAGAGAGATTTCACTTAGTACACGCCTCCAGTAAGCACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGA
TGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCACTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGT
TTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCAC
TCGAACAGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCA
GAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGA
CGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATC
AGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGG
CAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCTCTGG
ATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTAACTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCG
CCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACTATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCG
GCCCTGGTATCAGGGAAACCACCGGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGG
ATCCAGGCACTTAATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCGGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCC
TGCGTTATCTAAGAGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCGTTGCTTGGATCTCAACTCGTCGATCCCTCTGCAGGATCGTTCGC
GGAGTTGGATATGAAGGCCGATCCACCAAGGGCCAGTTAACTCCGCCGGGGGCTCTACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACGCCAG
ATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCTCCTACGGATACCGTCCTTCGCTAGCCATCGCCCGATCTCCTCATAATGG
TCCAGTAACAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGATTACGGTAGGCACCCATTTCTCGCCCCGAGTGA
CCCACCGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCATGTCTCTCCGGGCTCGATCCAGGTCGACTTATCCGCCCTTATGATCCTCAT
CCTCGCCCCGTACAACGGTCGCCGTCCGTTGATTTGGATCCGCATCTCGTCAGGGAAACAAAATGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGT
ACCATGAAACCCATCCCGAGGATGGCGTCTTGACCCGCGAGATCTCCAACCCAGATGTCAAACCAGTACACCAAACAACCTGCCAACGTGACCTTGACCC
GCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGT
ATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTCTTGCCCCCTACCTTGGCTTGCCTGAACCACTTTCCTGGGGCA
TGGTACTTCTAGTATCCACGGGACTCCCGGGTTAGCAGATCCA