Description :
From Genome Similarity Track
Location :
Scaffold_922:64- 4315
Sequence
4251 bases(100 bases per row)
CGGCACTTGGAGGTGTAGACGACAATGTCCTGTCATTCCTAGATAAAGCAGCAGGGCGGCCGTTCTTCTAGAAGAGGAGTTCGTAGATCAGCCGAATCAA
TCTTAGGGTGAAGAAACTCTGAACAATGCATGTTGTCGAAGATGTTGTCAGCGAAGCTGTGACGGGGTCACACAGCACCTTGCGCTAGAGAAAGTTAGCT
TCCCAAAGTATAAAAACGCTCAGTGAACGGCAGCTCACAGGTCTCCTCTTTATTCAAAAGAAAGCGAAGTGACCTATTTAAGGTAGAATGTAAACTGAAT
ATATTTATACGTAGATAAAGCTTGGGTTTAATACAAATTATAAGTCACCTATAGAAAAGCAATGTCATCAGCCAATGGTTGGCTTTGGACGACCTTGGTA
CCTTGTACCAAATATACCGAAGAATGACGTGTCACTGTTTATGTAACTAGGGGTACACTTAGGGCTACGTACCCCGTTACAATCTCCCCCACTAAGGTCC
GGTTTACCGACCATTCAGAATGAAGAGGTGTTTGTCACAAATTTTCATTCTCAAAGTCGAAAACCATCGACTTGGCCGCGCGAGTGCGGCGGAGGCTCAC
TTCACAGTTAGAGCCTCGAGCAGCAGTCTGTGCACCCTTCTTCTAAATCTCCACTTCGACCGTTTACTATGCCTCGTGGCACTGCAAAGAGCGGTGCGAA
GACACGCTCCAAGGCTGCTGCCGGAAAGGCGCAAGCCAAGAGCGCTAAGCCTCACGGCAAAGGCTCGGCACTTCAGGAGGCTACTCAGGTGGCCTCCGAG
GCGATCGGTCCCTCGGGAGACGCGGTTGTAAGCAAGCGAGCAAGCAAGCGCTGCGGCCCGTCGCCCTCGGCCTCTCCAGACAATCGTCCGAGCCCTCGGT
TCGCTGAAAGTGAGTTCGACTCTGGCAGTGAGGATGAAGCCGAGTCCGAGAGCACGCGCGATGCTCCTGCGGGCTCTGCAGGAGGGCACAGCCCAGTGCC
GAGCGAGCACAAGGACAACAGCGTGCCGTCGCTCGCTAGTGATCAAGGTGATCACAGTCCCAGGACGTCTGTGCGCTCTGAGTGTTCGGCCGTCAAGGCT
AAGAGCACTCCCAAAACTGGTGGCGATGAGGAAGAGAAACCTCGCAAACGTCTCTCGCTTGCCGAGGGTCATGCGCGTGCTAAGGCCTCTAAAGCCGAAG
GCGCCAAGCCTTCTAAGAAGCGTACGGCTTCTAAGCCTCCACTTCGCGAGGAGACGGAGACTCGTTACTCCCATCGTGGCCTCTTCGACTCCTCGGATGA
AGAGGGTCGAGAAGGAGGAGGAAGAGGAAGGTACTATCTCTGAGCCCCGGAAGATCACGAATGACCTCGACCAGCAGCAGGAGGCCTTCCAAGCTGCCCA
GCGTGTGCGTGGGGGGTTCGGTGGTGGAACCAGTCAGCCAGGAAGCTGCCATCGACTTAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTAATCT
CTTCCTGGAGCTTCTTGTCGCTCCTCGTGGCCTTGTTGGCGGCCACACCTCTAGGGGTGTTTATGAGCGTACCCTTGTTCAGAAGGAATAGTTGTTTGCT
GACAGCTTGGAGGCGGCTCGGTGTGTGCTTCTCGCGCCACACCGCATCCCTCTTAAGGACTTCACTACGTGTCGCAAGAAGCCCGAGAACCGGGGTGGTT
CTACCCTCTTTGGGGCTACCCCTGGGTTCTGCCCGAGAACTGTCCCACTTGGAGCTCTTGTGAGGACATGTTCTGGGCTTGGGTGGAGTCCCTCAGGTAC
TCACCCACAGAGTTACGGGAACTCCATGAAGATCAGCTGATGTCCCACATCCTGGACCAGCGTGATCTTCGTGTTCGGTTTTCCCACATGGTCAGCAAGC
GCATGCTGCCAAGGGACATCCTGAAGCGCGCGACTTCAAGCGCTCATGATGAGCGCGGGGTACGGAGTGTCTTCAACGTCCGTACGCCGGCTCGGGCAAG
AAGCCCCGACTACTTATGAAGCTGCCGGCGCTTCTGTTCCCAGATTGCGACAGTTTCGGGCAGTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAAC
CCCTCCACTTCACGAGGAGCTGTCGCTTACGCGACGCTGGTGCTCCTGGAGGATCCGCTCCACGTGGTTGTGGACTTCTCCATTCCGGTTAAGCAGAAGC
GGAAGTGCCCTCATACGAGAACGAGTACTCGGCGCCTCCCGAACGCCACTTTCGTCCGAGTGCTTCTCCTGCGGGTCCGACACAGGGCCCTGAGGTTGAC
CGCCTCCGTCAACGTATCCTCGTGCTTGAGATTGCACTTAACCTTGGGACTTGCGGTGATGCTGCCGCCCAGGCCGGGAATCAAGGCGAGATCGCTCGTC
TTGCGGGCCGCCTGGGCCTGTTGGGGCGTGAGTTCGCGAGCCTGCATCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTCCGCAT
GAAACGACGTATCGAGGCTCTGTTGCCACGTCCGGAGCCCCCTATGACGCACTCCCAGACGTTCTTTATATAAAACGTCCCCGACGTTCTCGGCGTATGG
CTACGGGTTCCGTTCGTACGAAGCCCTTGGGCGCAACTCCGGGACAAATAAGGCTTCCGCCAAAGCCGCGGTTACTAAGTAATAGGGAAGAGCACTGAAG
TGTCAAAACCTTGCATCGATGCAAACAGCTCCAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCTCTTCTCCGAGACCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGA
GTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCG
AGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTAGGACTGTGATCACCGTGA
TCACTAGCGGGCGACTGCACGCTGCCTGTAGTGGGCCACGCCATTACATAAGTAGGTAGATTTATATTACAAAAGTAGGTGCAGCAGCACACGGCTAGCG
TGTGCTGAACTGCCGTCATCCTATTGGTTGATATATGGGGAGCCAGACCCATTATCACCCAAAAAGGGTTTGACGTGTATTTGAGTGGTCAGGGCAAGCT
GCCCTGGACCTAAATAAAAACAGAGTTGATTTTCCTTCAGACTAAGCACTTGGTTTCACTATCGCGGAACTTGCACGCTTCCTCATTATTACGTGTAAGC
TAGTAACGGACACTCTAGGCCCGTTCCACCTGGTAGCACTTAGTAGTCCTTCCCATGACCAAGTTCACAATGAGCCAAGGCCAGACGTCTGAAGCTTCAG
GGCCAACCCTGGAGCATGCTGCTTTCCCTCATCTCACTCGTGTCGAGTGGGAAGCCTTTCACCGCCTTGCGGCGGTGTCCGGTGAGGCTGTTGTCGCGTC
GCTGCTGAGCTCAGCGACTCCCGATCAACAACGTCAAGCAGCTCAAGAGTTCATGGAACGCGAGCTCGCCGACGCGAATCGGCGAGCGACAACTCCCTCG
CGTTCCTCGAGGAATGACATCGTCAAGTTGGAAACGTCAACCTACTCCGGTGAAGGAGCGAATCGCCTTCCGTTGAATCGCTGGTTTCGCGACGTCGACA
TCGCTATCGCCTCGAGGATGATCGAGGCGCAAGGAGCGAAAGTTAACTTCTTACTTTCCCGACTGGCCGGGAAAGCCAAGGAGTGGGCACTCGGCAAACT
GGTCGTAAACAACGATGCGTTCTTCACCCTGGAGGCCCTCCAGAGTGTTCTTCGTCTCGCCTTCGAGCCTCCACAAGACGAGTCCCGAGTGCGCGCAGAG
TTCTTCGCTCTGCGACAAGGCAAGATGACCATGCGCGACTACGTCCAGAAGACACGCCACCTCGCGTCCTGCATCGTCACCAATCCGATTGACATGGCAT
CTCAAGTCCACGTCTTCGTGTTCGGCATGCGTGAAGGCATGACGCGATACTGTCTGACTCGAGCGGAACCCTCCTCACTCGAGGAGGCATTTGCTCTCGC
ACTTCGTGAAGACTACGTGGTGGCGGCGTCGTACGCGCGGGCAATGTCCGC