Description :
From Genome Similarity Track
Location :
Scaffold_4169:64- 1418
Sequence
1354 bases(100 bases per row)
GGATCTCAACCCGTCGATCCCTCTGCAGGATCTATCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTC
TGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATA
CCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTC
CTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTCTTTCATGTTCCGCCCACTTTAACCGGTCTGGCAGCTCCCAATTTTCCCCGGG
CTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAA
AGTGTCCCATCCGCCAGATTTAACCTCACTCCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAA
ACCAATACACCAAACAACCTGCCAGCTCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACT
TGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTA
CCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACA
GGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGT
GCCTCTCCCCTTTGTAGATCCAGGGTTGAGGAAGACTTCGGATTCGGCCAAACTAATCCCCTGGGCCCAACCTAGAGATCTTGGCAACTGACACTTCATG
TAGATCACGTGTATTATCGACGGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCT
CGTACCGGATTCAAACCCGGCGAGCGTCCTACTTTAACATCTTCTCGGCCACTACTGGCAATATCCCTCTGTGCTTGGCAGGATCAAACCATTGGCGCAT
CGGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACA