Description :
From Genome Similarity Track
Location :
Scaffold_2307:64- 1369
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2307-fgenesh-gene-0.0UPF0171 family protein

Sequence
1305 bases(100 bases per row)
CGACGTGGATCCGCAGACGTTCATCGACGTGTCGCTCGGCAAGAGCGTGCTCGCGAACGACCTCAAGAGCGTCTACCACGGCCTGGACGAGTCCGGCACG
GCCCACGTCGTGATCAACCGCTGGGTCAAGCTCTCGCTCACGCTCACGGACTCGGTCGCGGTCAAGATGCCCAACCTGCGACCGTACCACACGCTGCTGC
TGCTCGCGGACGAGGACAAGATCCTGGACTCGCTGCCAGCCGACCACTCACAGCAGCTGCGGCTGCTCATCGAGGTTGCCAACCCCCTCAAGAGCTTCCA
GGAGCTCGCGCTCGAGACGTCGATCCCGATCCACCAGATCTTCCGCCTCTCGGCGCACCTGGTCTACTGGGGCTTTGGCAAGGTCGTCGACACGATCACG
CTGCGCAACATCTACCAGGTCAACCCGCAGGCCAAGCTGCGCGCGCACTCGGCGCTCGCGCTCGAGTTCCGCCGCAAGTTCGCGCCGCACGAGCTCAGCG
AAGTGCTCTCGAGCTTCTCTGGCTCGCGCTCGATCAGCGAGTACTTGAAGAACCTCTCGGCGCAGAAGAAGGCCGAGTACGTCCACATGCTGGTGCGTTC
TTGTCATGATCATGGTTCTGATAGCTACAGTGAGTCGTCGATGGACACTAACATTGTTATCGCTCCCTCCGCTTCGTAACCCTTCAGATCTGGCTCCTAC
AACAGAACTTCATCATCCAGCTGCACCGCTACGTGTACTTCATGATCCCTTCCGAGGGCGACCACGCGACTTCGTCTGACCAGTACCACGAGAGCAACGG
GTCGTTCGAGAACAACTCGTACGGGTCCAATCAGCTGTCATACCAGCGCCACAACAGCCGCACCAGCAGCTTCCTGGGCGGACTCGGCTCGCACACGCCG
CCACTGCTGCCTTCGTCTGTGGGCGAGCTCAACTACCACCACCACCAGCAGCCGCAGCCGCTGGACTCGACCAACTTCTCGCTCCAGTCGTTCATGACGT
CCAAGTCCTCGGTGATGACGGGCGCATCAAGACCTCACCAGCAACACACACAGCTCAAGCCACGACTGCTCCATGATGCGCCACCAACGGGAAACAGTAA
CAACCCATTTGCGCTCTCGGAGCGCGAGCGCGAGTACCTAGACCGCATCGCGACGACCAACCCCGTGTACACGCTCTTCAAGCGCCTCTGCGTTTACTTC
CACGGCCAGTACCACCTCGAGGAGATCATGTGGCGCGAGAACGTCTCCCGCAGCGAGCTGCGCACCGTGCTGAGCACGTACCAGGACATCATCGTCTGCT
GTCTG