Description :
From Genome Similarity Track
Location :
Scaffold_1764:64- 1321
Transcript NameFunction/comments
Phyra_87278PREDICTED: uncharacterized protein LOC100497668

Sequence
1257 bases(100 bases per row)
GGAGTCGACATCCGGCTGTGCATCGACTACCGTTTGGTGAATAGCCTGACCAGGTTGATGGTATATCCCATGCCGCTGATCAACGATCTCTTGGAGGACT
TGGACAAAGTACTCTGGTACTGCTCTTTGGATATGGCTAGTGGTTTTTGGGTGGTCTCCATGACGGAACGTGCACGGAAGATCTCCGCGCTCGTTACGCC
TTTCGGACTCTTCGAGTGGACGCGTATGCCCTTCGGGCTGAAGAATGCCCCACAAATCTACCAGAGGCTCATCGATAATGCTCTGTACGGATACCTCCGG
ATAAGCCCTGATCGAGACCACGCGGAACCAACTGACGTGTTCGAGAAAGGGGAACCCGAGGCAAACCCGGGACCTTCGGTACTGGGCAGGCGATCGTACA
TCGACGATATCCTGATCACCGCTGACACCTGGGACACGATCTGCGAGAAGGTCGAGGCTTGACGCTTGCGAGCGATGGAACCTGTCGATCAGCGTGGTCA
AGAGTTTCTGGGGACATCGGAAGGTAGAGTACTTGGGTCATCGGGTATCGGCCGATGGTTTGGAAGCCAATCCGAAAGATCTGGAATCGCTGGAGAAGCT
GTCGTTTCCGAAGACGTTGCGATCGATGCAGTCCTTCTTAGGAAGCCTGAATTATTACAGTCGCTTCATTGAAGACTTCGCCGTTTACGCCGCGATCTTA
TACGAACTGCGAGAAGTGGACTTCTACGAGATGCACCATGGGAAGCACGGAGACCAAGCAACGGAGTCCGATGATCGGTGGACCAGAGCAAGAACGGCGT
TCGACCTACTGAAGGCCAAGCTTGCGACCACTCCGATTTTACGACACTTCGATCCCGATCGCCAGCCTGTGATCGTGGTCTATGCCAACAAGTGGGCTAT
CTCAGCTGCGTTGGTTCAGGAACATGATGGTATGTATTGGCCTGTGATCTTCACCAGTCGTACGCTGAAGTCAAACGAATTGAATTACGGCATAGTGAAC
AAGGAAGTTTTGGCGCTCCTCCGGATCTTGGATGTGTGTTACACGTTCCTGACCAACCGATCGATCAAGGTGCTGTCGAGGTACTCGACGCTCGCCTGGT
TGCTGAATTCGTCTGGCTTCCAGGGACGATTGGGACGATGGGCAGCTCTGCTATCCGAGTGGACCTTGGAAATCCGGAAGTGCTTGAAAGGAGAGGACGA
AATCCTGGGCGCGATCGCCGCCAGCATTACACCCCGAGCGGAAGTGGACGAGGCCTT