Description :
From Genome Similarity Track
Location :
Scaffold_86:64- 1205
Sequence
1141 bases(100 bases per row)
ACTACATGTTTCATCACTGTTACGAATGCGCCTGTCGCGAGGCGCACCGTCATCATCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTTTGCTGT
CTAGCGATTGGAGTCGTACAAAGTTGCTCGACTCCCCACAATAGACTAGAGCTCGAAGCGACATGCCTTGTGTCACTTCGAGTTTCAAGGTAATGAGGTA
AACCTCATTACCAGAAGCAGAAACACACAATGACTGAGTGTTGGGATCAACTTTCGTCAAGAAGCCTACAAACTCACTTGACGTTTCTGGATCAGTAGGG
TGCTCCGCACCTACTGACCCTGACCGTTTTTTTGTTGTCCGTTATGTTGTTGCGAAAACGCAACAACGTCGGACCCACGCCTTGGACCTCGCTTGGCCGC
TTGGCGGTTACTGTTTCCTGCGGTACGTGGTACCGCGCTCGAGGCACTGCATTCAAATGCATAATGCCCTATAGATGTCAAAAGACAGGGGTCTTTTGAC
ATCTATTGCATTTTTTCAATTTCTTATAATTATTAACACGAGAGCTCTCGCTCCTCGCGTTACAGAGGTTCACTGGTTCTGGGCCTTTATTTTCCTGTCG
TCTCGATGGACGATAGGAATTCGAATTCGTGTGAGCCTGTTTCATGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGTCTCTTCCAGGATGTTGAACTCC
AACCGGAACACGTAGATTTTAACAGGACCATCAGTCAGATCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCAACTGTTATGCAACTGG
TAAGGAGACGTATGTACTGAATGTACGAGTGTACATCACGTTTACCTTGCTTGTTCACAGAAGTTCAGAGCGAGCCCTGAACTCAGCTCCCGGCGGCTCA
AAAGTTTGCCTAAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATGTGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGTCA
AGTTCGATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGGCGAGCCTTTATGGCATCGTCTAGTTCCACGAACCATCTCAAGAGAGAGTCTTC
ATCGGCTCCCTTGTACTTTGAGATGTTAATCTTTAGAGTCT